Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Letter to the Editor
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • critical-appraisal
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • non-scientific
  • Obituary
  • original-paper
  • original-report
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • review-paper
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • short-communication
  • short-report
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • In Jour Smart Sensing And Intelligent Systems
  • Polish Journal Of Microbiology
  • Journal Of Nematology
  • Advancements Of Microbiology
  • Australasian Journal Of Neuroscience
  • Australasian Orthodontic Journal
  • Architecture Civil Engineering Environment
  • Immunohematology

 

Article | 09-November-2020

The gel test: sensitivity and specificity for unexpected antibodies to blood group antigens

The recently FDA-licensed anti-IgG gel test for pretransfusion antibody detection requires crossover validation before implementation. Six hundred coded samples sent for routine pretransfusion tests were used to compare GEL (ID-MTS, Ortho Diagnostic Systems Inc., Raritan, NJ) with Löw and Messeter’s low-ionic-strength saline (LISS). There were 456 GEL–LISS–, 97 GEL+LISS+, 45 GEL–LISS+, and 2 GEL+LISS– tests. The 144 positive tests involved 157 antibodies; 67

W. John Judd, E. Ann Steiner, Pamela C. Knaf

Immunohematology, Volume 13 , ISSUE 4, 132–135

Article | 18-October-2020

Comparison of tube and gel techniques for antibody identification

There are several methods for antibody detection and each technique has advantages and limitations. We compared the performance of the tube (polyethylene glycol–indirect antiglobulin test [PEG-IAT]) and gel test technique for antibody identification. From January to May 1999, we performed antibody screening tests by gel and tube techniques on 10,123 random blood samples submitted to our reference laboratory. Six hundred and twentyeight (6.2%) reactive samples were tested for antibody

Marcia Cristina Zago Novaretti, Eduardo Jens Silveira, Edio da Costa Filho, Pedro Enrique Dorlhiac- Llacer, Dalton de Alencar Fischer Chamone

Immunohematology, Volume 16 , ISSUE 4, 138–141

Report | 01-December-2019

Single-center comparison of gel microcolumn and solid-phase methods for antibody screening

Our facility changed antibody screening methods from a gel microcolumn–based test (ID-Micro Typing System Gel Test; Ortho Clinical Diagnostics, Inc., Raritan, NJ) to an automated solid-phase test (Galileo/Capture-R Ready-Screen [I and II], Immucor, Inc., Norcross, GA). To determine whether detection rates for commonly encountered clinically significant red blood cell antibodies differed as a consequence of this change, preimplementation and postimplementation antibody identification

Anne Schmidt, Brenda J. Bendix, Eapen K. Jacob, Sandra C. Bryant, James R. Stubbs

Immunohematology, Volume 29 , ISSUE 3, 101–104

Article | 03-November-2020

The gel test: use in the identification of unexpected antibodies to blood group antigens

The IgG GEL test was compared with the LISS tube test (Löw and Messeter’s low-ionic-strength saline) for antibody identification. The suitability of red blood cells (RBCs) pretreated with ficin, dithiothreitol (DTT), or chloroquine diphosphate (CDP) also was assessed for use in the GEL test. In addition, time-in-motion studies were performed comparing GEL (12 panels per batch) with polyethylene glycol (PEG) tube tests (3 panels per batch). In 57 antibody identification studies, there

W. John Judd, E.Ann Steiner, Pamela C. Knaf, Colleen Masters

Immunohematology, Volume 14 , ISSUE 2, 59–62

Article | 14-October-2020

A gel microtyping system for diagnosis of paroxysmal nocturnal hemoglobinuria

lysis (MIRL [CD59]). We evaluated the diagnostic value of a simple hemagglutination test using the gel microtyping system by comparing it with lytic tests (the Ham test and the sucrose lysis test) and with flow cytometry (FC) assessment of expression of GPI-anchored proteins (CD59 and CD55). Examining 51 blood samples from 48 patients, we found that the gel test is useful as a screening test for PNH diagnosis and can replace the Ham test and the sucrose lysis test. The threshold of the gel test is

Barbara Zupanska, Irena Bogdanik, Hanna Pyl

Immunohematology, Volume 18 , ISSUE 1, 9–12

Article | 03-November-2020

Implementation of gel column technology, including comparative testing of Ortho ID-MTS with standard polyethylene glycol tube tests

With the intent to increase laboratory efficiency and according to the Clinical Laboratory Improvement Act of 1988 (CLIA ’88), a parallel testing program comparing traditional tube technology with the gel system technology was undertaken. Test tube indirect antiglobulin tests were performed using polyethylene glycol (PEG) as the antibody enhancement medium. Gel (GEL) column technology used the ID-Micro Typing System™, using predispensed anti-IgG and lowionic-strength saline for

Diane A. Derr, Stacy J. Dickerson, E.Ann Steiner

Immunohematology, Volume 14 , ISSUE 2, 72–74

Article | 14-October-2020

Comparative testing for weak expression of D antigen: manual tube testing vs. a semiautomated IgG gel system

Donor RBCs nonreactive in initial tests for D must be tested further for evidence of weak expression of D antigen. Performing this test in test tubes is labor intensive and prone to inconsistencies in readings (relative strength of agglutination) and interpretation (positive versus negative). These inconsistencies can lead to repeat testing, additional documentation, and delay in releasing units. We evaluated use of the Tecan MEGAFlex-ID™ pipettor to perform this test in anti-IgG gel

Bill A. Martinez, Liz A. Crews, Arlene M. Dowd, Melissa McMahan

Immunohematology, Volume 19 , ISSUE 1, 7–9

Article | 03-November-2020

Comparison of gel technology and red cell affinity column technology in antibody detection

Both column (gel) agglutination technology and red cell affinity column technology (ReACT™) have been approved by the Food and Drug Administration for antibody detection and identification. Parallel studies using these two methods were performed on 100 samples to evaluate their sensitivity, advantages, and disadvantages. Sixteen significant antibodies, anti-D(2), -C(1), -E(1), -c(1), -C,D(1), -K(4), -S(1), -Fya(3), -Jka(1), and -Jkb(1), were found during the study. MTS-Gel detected one

Sauvai I. Chanfong, Sherri Hill

Immunohematology, Volume 14 , ISSUE 4, 152–154

Article | 14-October-2020

Antibody screening in 37°C saline. Is it safe to omit it using the indirect antiglobulin (gel) test?

Pretransfusion tests must detect antibodies that can shorten the life of red blood cells (RBCs). Some studies have demonstrated the existence of clinically significant antibodies detected at 37°C in saline that are not detected by the indirect antiglobulin test (IAT) when the conventional tube test is used. Our aim was to determine whether these antibodies, detected with a 37°C saline tube test, are also detected when a sensitive column gel agglutination method is used. The 2373

José A. Duran, Manuel Figueiredo

Immunohematology, Volume 18 , ISSUE 1, 13–15

Article | 01-April-2020

Application of gel technology in the serologic characterization of autoantibody in DAT-positive autoimmune diseases

Gel tests are now available for the determination of immunoglobulin classes and subclasses and complement fractions coating RBCs. These tests simplified serologic characterization of autoantibodies in various autoimmune diseases. The aim of this study was to evaluate the use of gel cards in the serologic characterization of autoantibody with regard to the immunoglobulin classes, complement fractions, and IgG subclasses, and the influence of these characteristics on hemolysis. Gel cards were

Sudipta Sekhar Das, Rajendra K. Chaudhary

Immunohematology, Volume 23 , ISSUE 2, 59–62

Article | 15-May-2020

The sensitivity, specificity, and clinical relevance of gel versus tube DATs in the clinical immunology laboratory

The DAT is a test used to demonstrate in vivo antibody and/or complement coating of RBCs. Typically, the DAT is performed in test tubes; however, recently a number of commercially available tests using gel-filled microtubes have become available. Few data comparing the sensitivity of these test media are available. To compare the rate of detection of a positive DAT performed in test tubes versus in gel-filled microtubes and to assess the clinical significance of the results in patients

Na’ama Paz, Dganit Itzhaky, Martin H. Ellis

Immunohematology, Volume 20 , ISSUE 2, 118–121

Article | 03-November-2020

Comparison of tube and gel red blood cell agglutination techniques in detecting chimeras after major ABO-mismatched allogeneic hematopoietic stem cell transplantation  

We compared the ability of tube and gel red blood cell (RBC) agglutination techniques to follow erythroid engraftment in a patient who received a major ABO-mismatched peripheral blood stem cell transplant and bone marrow transplant. Tube and gel RBC agglutination techniques were used to detect mixed-field reactivity in cell mixtures containing A/O and c+/c– RBCs and the ability of these two technologies to detect RBC chimeras were compared. We detected c+ RBCs in c+/c– RBC

Marni J. Kupferman, Karen M. Cipilone, Jo Lynn Procter, David F. Stroncek

Immunohematology, Volume 14 , ISSUE 2, 63–67

Report | 14-March-2020

Comparison of gel test and conventional tube test for antibody detection and titration in D-negative pregnant women: study from a tertiary-care hospital in North India

Conventional tube testing was used for antibody screening and titration in D– pregnant women in our hospital until the recent introduction of the gel test. In this study we assessed the sensitivity of the gel test in our setup and tried to establish a correlation between these tests for determining antibody titer. We collected 652 blood samples from 223 antenatal D– women during a span of 1 year. The samples were tested separately by the conventional tube technique and the gel test

Manish K. Thakur, Neelam Marwaha, Praveen Kumar, Subhash C. Saha, Beenu Thakral, Ratti Ram Sharma, Karan Saluja, Hari Krishan Dhawan, Ashish Jain

Immunohematology, Volume 26 , ISSUE 4, 174–177

Report | 01-December-2019

Comparison of estimation of volume of fetomaternal hemorrhage using KleihauerBetke test and microcolumn gel method in D-negative nonisoimmunized mothers

In this study we assessed the efficacy of the microcolumn gel method in the detection and quantification of the volume of fetomaternal hemorrhage (FMH) in comparison with the Kleihauer-Betke test (KB) in nonisoimmunized D– mothers. We collected blood samples from 80 D– indirect antiglobulin test–negative mothers over a span of more than 1 year. FMH was determined by KB and microcolumn gel method, and the results were compared. FMH was recorded as less than 4 mL by KB if no

Kshitija Mittal, Neelam Marwaha, Praveen Kumar, Subhash C. Saha, Beenu Thakral

Immunohematology, Volume 29 , ISSUE 3, 105–109

Article | 14-October-2020

Comparison of three low-ionic diluents for dilution and storage of reagent A1 and B cells for testing in gel technology

Currently, ABO serum grouping performed by gel technology employs a red cell diluent containing EDTA (MTS Diluent 2 Plus™) that does not permit extended storage of the red cell suspensions. A diluent currently used for suspension and long-term storage of reagent red cells for antibody detection and identification (Ortho 0.8% Red Cell Diluent™) was evaluated for use with A1 and B cells. Because this diluent does not contain EDTA, testing was limited to EDTA samples. As a comparison

E. Ann Steiner, LouAnn Dake

Immunohematology, Volume 17 , ISSUE 2, 53–56

Article | 01-June-2012

SYNTHESIS OF SrTiO3 NANOPOWDER BY SOL-GEL- HYDROTHEMAL METHOD FOR GAS SENSING APPLICATION

Strontium titanate (SrTiO3) nanopowder has been synthesized through a sol-gel-hydrothermal method. The X-ray diffraction studies of SrTiO3 nanopowder have shown that the as-prepared powder was single phase, crystalline, and has a cubic perovskite structure (ABO3) with a lattice constant a = 3.903 Å. The particle size calculated from FWHM was ∼22 nm. SrTiO3 nanopowder was examined using thermo gravimetric analysis; differential thermal analysis and UV-visible absorption spectroscopy

D. D. Kajale, G. E. Patil, V. B. Gaikwad, S. D. Shinde, D. N. Chavan, N. K. Pawar, S. R. Shirsath, G. H. Jain

International Journal on Smart Sensing and Intelligent Systems, Volume 5 , ISSUE 2, 382–400

Article | 18-October-2020

A gel technology system to determine postpartum RhIG dosage

Failures of Rh immune globulin (RhIG) prophylaxis occur when the dose is too small. We report a test using a gel technology (GT) method to replace the Kleihauer–Betke (K–B) test to assess fetomaternal hemorrhage (FMH) and assist in determining the minimum necessary dose of RhIG. Cord blood (O, D+) was mixed with adult blood (O D–) to mimic an FMH of 10 mL, 20 mL, 28 mL, and 40 mL. Test samples were incubated with anti-D at known concentrations and centrifuged. The supernatant

John R. Fernandes, Ronny Chan, Ahmed S. Coovadia, Marciano D. Reis, Peter H. Pinkerton

Immunohematology, Volume 16 , ISSUE 3, 115–119

Research Article | 27-December-2017

SYNTHESIS, CHARACTERIZATION AND GAS SENSING PERFORMANCE OF SOL-GEL PREPARED NANOCRYSTALLINE SnO2 THIN FILMS

Nanocrystalline SnO2 thin films were successfully prepared using sol-gel dip coating technique. The starting precursor was used as tin chloride dihydrate (SnCl2.2H2O), ethanol and glycerin. As the prepared films were fired at 500oC. These films were characterized using XRD, FESEM and TEM to known crystal structure, surface morphology and microstructure property. Elemental composition was studied using energy dispersive spectrophotometer (EDAX). The H2 gas sensing performance of nanocrystalline

Ramesh H. Bari, Sharad B. Patil, Anil.R. Bari

International Journal on Smart Sensing and Intelligent Systems, Volume 7 , ISSUE 2, 610–629

Report | 26-October-2019

Comparative evaluation of gel column agglutination and erythrocyte magnetized technology for red blood cell alloantibody titration

Antibody titration is traditionally performed using a conventional test tube (CTT) method, which is subjected to interlaboratory variations because of a lack of standardization and reproducibility. The aim of this study is to compare newer methods such as gel column technology (GCT) and erythrocyte magnetized technology (EMT) for antibody titration in terms of accuracy and precision. Patient serum samples that contained immunoglobulin G (IgG) red blood cell (RBC) alloantibodies of a single

Anju Dubey, Atul Sonker, Rajendra K. Chaudhary

Immunohematology, Volume 31 , ISSUE 1, 1–6

Article | 14-October-2020

Selecting an acceptable and safe antibody detection test can present a dilemma

The Transfusion Service at Duke University Hospital has changed antibody detection methods from the use of albumin in indirect antiglobulin tests to low-ionic-strength solution (LISS), and from LISS to polyethylene glycol (PEG) in an effort to enhance the rapid detection of clinically significant antibodies. In 1996, staffing issues required the consideration of automation. Although previous studies indicated that the gel test was not as sensitive as PEG for detection of clinically significant

Martha Rae Combs, Steven J. Bredehoeft

Immunohematology, Volume 17 , ISSUE 3, 86–89

Article | 10-November-2020

The impact of a gel system on routine work in a general hospital blood bank

The gel system has been reported to be more sensitive and specific than the conventional tube indirect antiglobulin test (IAT) for anti­body screening. However, a major concern about the gel system is its cost. A cost analysis study was therefore conducted at our hospi­tal. The gel system costs more than the conventional tube IAT per test; however, the total staff and reagent costs per year were about equal, because of staff savings. Workload and cost per patient requir­ing blood

A. Chan, H.F. Wong, C.H. Chui, L. Wong, G. Cheng

Immunohematology, Volume 12 , ISSUE 1, 30–32

Article | 18-October-2020

Red blood cell diluent composition is important for detection of some anti-E

Commercially prepared 0.8% reagent red blood cells (RBCs) eliminate the need to manually dilute 3 to 5% RBCs for use in gel cards. Ortho-Clinical Diagnostics investigated twelve anti-E samples detected in MTS Anti-IgG gel cards using Ortho 3% reagent RBCs manually diluted to 0.8% in MTS Diluent 2™ (MTS2) that were not detected with commercially prepared Ortho 0.8% reagent RBCs. In gel tests, using additional examples of E-positive RBCs, 22 of 26 antiE were reactive when the cells were

Dania D. Yaskanin, Janice L. Jakway, David J. Ciavarella

Immunohematology, Volume 16 , ISSUE 4, 142–146

Report | 12-March-2020

Determination of optimal method for antibody identification in a reference laboratory

Methods commonly used for antibody identification are hemagglutination (tube), column agglutination (gel), and solid-phase red cell adherence. Our AABB immunohematology reference laboratory (IRL) conducted a study to determine which antibody identification testing method was optimal for detecting all clinically significant antibodies. Patient specimens were sent to our IRL from August 2008 to September 2009. Routine testing was performed by tube method and then by manual gel and manual solid

Jennifer R. Haywood, Marilyn K. Grandstaff Moulds, Barbara J. Bryant

Immunohematology, Volume 27 , ISSUE 4, 146–150

Article | 30-July-2021

Effect of bromelain and papain gel on enamel deproteinisation before orthodontic bracket bonding

shear bond strength at failure. The material remaining on the tooth was assessed using the adhesive remnant index (ARI). Results: Deproteinisation with 3% and 6% bromelain gel plus papain significantly increased the shear bond strength (p < 0.05), when acid etching was performed with phosphoric acid, followed by primer application and attachment using Transbond XT (Group 3) and when attached with RMGIC without etching. Deproteinisation with 6% bromelain gel plus papain significantly increased (p

Matheus Melo Pithon, Matheus Souza Campos, Raildo da Silva Coqueiro

Australasian Orthodontic Journal, Volume 32 , ISSUE 1, 23–30

Report | 29-October-2019

Indirect antiglobulin test-crossmatch using low-ionic-strength saline–albumin enhancement medium and reduced incubation time: effectiveness in the detection of most clinically significant antibodies and impact on blood utilization

; uncrossmatched ones. The objective of this study was to evaluate the performance of a LISS-albumin enhancer to intensify antigen-antibody reaction after 5 minutes of 37°C incubation and compare this performance with that of other enhancers, gel, and conventional tube testing. Second, the study evaluated the impact of this method’s implementation in the C:T ratio (crossmatched to transfused RBC units) of a transfusion laboratory. Ninety serum samples containing alloantibodies of potential clinical

Carla Luana Dinardo, Sílvia Leão Bonifácio, Alfredo Mendrone Júnior

Immunohematology, Volume 30 , ISSUE 1, 1–5

Report | 29-October-2019

Demonstration of IgG subclass (IgG1 and IgG3) in patients with positive direct antiglobulin tests

Serologic characterization of autoantibodies helps in the management and monitoring of the course of autoimmune hemolytic anemia (AIHA). The purpose of this study was to evaluate gel centrifugation test (GCT) cards for immunoglobulin G (IgG) titer and determination of IgG subclasses IgG1 and IgG3 and their influence on hemolysis. Eighty direct antiglobulin test (DAT)-positive patients were examined with the help of GCT cards for IgG titer and IgG subclasses. The results were correlated with the

Ashutosh Singh, Archana Solanki, Rajendra Chaudhary

Immunohematology, Volume 30 , ISSUE 1, 24–27

Article | 14-December-2020

Typing of normal and variant red cells with ABO, Rh, and Kell typing reagents using a gel typing system

In 1989 Lapierre et al. described a novel method of detecting agglutination reactions by the use of a Sephadex (DiaMed ID Typing System) gel held in a microtube. This report examines the use of gels containing ABO, Rh, and Kell system specific antibodies. The anti-A and -B were monoclonal reagents; anti-A,B, and those for the Rh and Kell systems were polyclonal. Five hundred and fifty-one tests performed for the ABO system detected all but the most weakly reacting variants, a detection rate

Don Tills, Derek J. Ward, Dieter Josef

Immunohematology, Volume 7 , ISSUE 4, 94–97

Article | 16-November-2020

Rhmod phenotype: a parentage problem solved by denaturing gradient gel electrophoresis of genomic DNA

support this hypothesis, DNA analysis of the RHD and RHCE genes was performed on the five family members. Polymerase chain reaction (PCR) products from exons 2 and 5 were analyzed by denaturing gradient gel electrophoresis (DGGE). The DNA results corroborated the serologic findings and refuted the exclusion of paternity.

Fiona J. Steers, Maura Wallace, Marialuisa Mora, Ben Carritt, Patricia Tippett, Geoff Daniels

Immunohematology, Volume 12 , ISSUE 4, 154–158

Article | 28-April-2020

Reactivity of FDA-approved anti-D reagents with partial D red blood cells

of IgM monoclonal anti-D blended with monoclonal IgG anti-D, one IgM monoclonal anti-D blended with polyclonal IgG anti-D, and two reagents formulated with human anti-D in a high-protein diluent. One antiD formulated for use by gel column technology was also tested. Direct agglutination tests by tube or gel were strongly positive (scores 9–12), with partial D RBCs of types DII, DIIIa, DIIIb, and DIVa. No reagent anti-D caused direct agglutination of DVI type 1, DVI type 2, or DFR phenotype

W. John Judd, Marilyn Moulds, Gloria Schlanser

Immunohematology, Volume 21 , ISSUE 4, 146–148

research-article | 30-November-2019

OVERVIEW OF SELECTED NATURAL GAS DRYING METHODS

removed and, as wet gas, enters condenser (5). In this place gas is cooled down and water vapor condenses. Liquid is taken out in water knock out (6). After that gas is compressed in a compressor (7) to compensate losses in the unit and equalize pressure with raw gas. At the end it is reinjected to the stream coming from well [15]. Figure 3. Scheme of adsorption drying process (source: [15]) The most commonly used adsorbents in gas drying processes are silica gel (SiO2), molecular sieves (zeolites

Natalia GENEROWICZ

Architecture, Civil Engineering, Environment, Volume 13 , ISSUE 3, 73–83

Research Article | 03-December-2018

A novel in vitro chemotaxis bioassay to assess the response of Meloidogyne incognita towards various test compounds

Plant-parasitic, root-knot nematodes (Meloidogyne spp.) are a serious problem in agri- and horticultural crops worldwide. Understanding their complex host recognition process is essential for devising efficient and environmental-friendly management tactics. In this study, the authors report a new, simple, inexpensive, efficient, and quantitative method to analyze the chemotaxis of M. incognita second-stage juveniles (J2s) using a combination of pluronic gel and agar in a petri dish. The authors

Tagginahalli N. Shivakumara, Tushar K. Dutta, Uma Rao

Journal of Nematology, Volume 50 , ISSUE 4, 487–494

Case report | 01-December-2019

A case of masquerading alloantibodies:  the value of a multitechnique approach

, D+ blood type showing strong reactivity with all cells tested  in the forward and reverse ABO, in the D testing as well as in a three-cell antibody screen. The initial assumption was that the plasma contained a cold autoantibody. Subsequent testing, including the use of gel column technology, ficin-treated cells, and antisera for phenotyping, showed the apparent cold autoantibody to be a red herring. Additional tube testing at immediate spin, 37°C, and indirect antiglobulin test (IAT

Paula M.S. Wennersten, Laurie J. Sutor

Immunohematology, Volume 30 , ISSUE 3, 117–120

Research Article | 12-December-2017

The Effect of Catalytic Metal Contact on Methane Sensing Performance of Nanoporous ZnO -Si Heterojunction

A sol-gel derived ZnO-p-Si heterojunction structure were fabricated and investigated as a potential methane sensor. Three configurations with different contacts (Pd-Ag contact both on ZnO and Si / Pd-Ag on ZnO side and Au on Si / and Au on both sides of the junction) were fabricated in order to study the impact of the catalytic contact on the methane sensing properties. Structural characterization with high resolution FESEM and EDX study revealed the synthesis of highly crystalline ZnO thin

G. P. Mishra, A. Sengupta, S. Maji, S. K. Sarkar, P. Bhattacharyya

International Journal on Smart Sensing and Intelligent Systems, Volume 3 , ISSUE 2, 273–291

Article | 15-April-2020

In search of the Holy Grail: comparison of antibody screening methods

improved sensitivity,with the occasional negative impact on relevant results. The focus on improving efficiency through automation, and personnel resourcing challenges of the transfusion service,have led laboratories to select methods tailored to meet their needs. This review compares the newer methods used in the gel test and solid phase test with commonly used tube methods. Both of the newer methods were developed with future adaptation to automation in mind. Further literature reviews about

Tony S. Casina

Immunohematology, Volume 22 , ISSUE 4, 196–202

Article | 27-April-2020

On a much higher than reported incidence of anti-c in R1R1 patients with anti-E

A previous study involving tube IATs, untreated RBCs, and a lowionic-strength additive reagent revealed that approximately onethird of R1R1 patients with anti-E have a concomitant anti-c. However,the current study finds a much higher incidence of anti-c in such patients, using gel technology in conjunction with ficinpretreated RBCs. Results of antibody identification studies and transfusion records of 82 R1R1 patients with anti-E were reviewed. Serologic test methods included a LISS wash

W. John Judd, Louann R. Dake, Robertson D. Davenport

Immunohematology, Volume 21 , ISSUE 3, 94–96

Case report | 01-December-2019

Performance of an automated solid-phase  red cell adherence system compared with  that of a manual gel microcolumn assay for  the identification of antibodies eluted from  red blood cells

IgG antibodies coating red blood cells (RBCs) can be removed by elution procedures and their specificity determined by antibody identification studies. Although such testing is traditionally performed using the tube agglutination assay, prior studies have shown that the gel microcolumn (GMC) assay may also be used with comparable results. The purpose of this study was to compare an automated solid-phase red cell adherence (SPRCA) system with a GMC assay for the detection of antibodies eluted

Rachel H. Finck, Rebecca J. Davis, Shih-Mao Teng, Dennis Goldfinger, Alyssa F. Ziman, Qun Lu, Shan Yuan

Immunohematology, Volume 27 , ISSUE 1, 1–5

Report | 25-March-2020

Rapid, single-subject genotyping to predict red blood cell antigen expression

isolated from fresh and 1- and 2-week-old stored blood from 20 donors with known ABO and Rh phenotypes and was used for ABO, RHD, and RHCE genotyping using SSPs.  The amplicons were analyzed using gel electrophoresis and a novel microfluidic onchip electrophoresis system.  Analysis of DNA from fresh and 1- and 2-week-old blood by SSP and gel electrophoresis yielded the correct ABO, RHD, and RHCE type in all samples, but with DNA from 2-week-old stored blood the amplicons were more difficult

Stefanie L. Slezak, Sharon Adams, Hallie Lee-Stroka, Joshua E. Martin, Lorraine Caruccio, David F. Stroncek

Immunohematology, Volume 24 , ISSUE 4, 154–159

Article | 14-October-2020

Tube and column agglutination technology for autocontrol testing

The incidence of positive autocontrol test results with column agglutination technology is a concern. This study investigates the incidence and significance of positive autocontrols in the ID Micro Typing System™(gel) and the Gamma ReACT™(ReACT). The study encompassed a total of 1021 randomly selected samples from patients and 95 samples from donors collected during 1 month. The autocontrol testing was carried out according to the manufacturer’s instructions for the column

J.E. Courtney, J.L. Vincent, A.J. Indrikovs

Immunohematology, Volume 17 , ISSUE 2, 50–52

case-report | 30-November-2017

The complications of jejunostomy tubes for patients receiving Duodopa: New challenges for neuroscience nurses

Background: An 80 year old man with advanced Parkinson’s disease (PD) was admitted to the neuroscience unit with a worsening decline in mobility. Medical management was the commencement and titration of the levodopacarbidopa intestinal gel (LCIG) Duodopa ® via a naso-jejunal tube, which had been inserted under fluoroscopy in Interventional Radiology. Over a ten day trial period the patient responded well to the administration of the LCIG with much less periods of difficulty with movement (known

Rachael Elizabeth Mackinnon

Australasian Journal of Neuroscience, Volume 27 , ISSUE 2, 1–4

Letter to Editor | 18-October-2020

Letters to the Editors Re: Gel technology for RhIG dosage

Stephen Apfalroth

Immunohematology, Volume 16 , ISSUE 4, 161–161

Research Article | 03-December-2018

Effector gene vap1 based DGGE fingerprinting to assess variation within and among Heterodera schachtii populations

, and sequence this gene from diverse species and populations of cyst nematodes. This resulted in a high diversity of sequences for H. schachtii, and allowed to design non-degenerated primers to amplify a fragment suitable for sequence dependent separation of gene variants in denaturing gradient gel electrophoresis (DGGE). The developed primers span a highly variable intron and part of a slightly variable exon. A marker comprised of the 14 mostly detected gene variants was established for gel-to-gel

Rasha Haj Nuaima, Johannes Roeb, Johannes Hallmann, Matthias Daub, Sandra Otte, Holger Heuer

Journal of Nematology, Volume 50 , ISSUE 4, 517–528

Research Article | 13-December-2017

LEAK RATE AND LOCATION ANALYSIS THROUGH SLITS AND CRACKS IN PIPES BY NANO POROUS CERAMIC HUMIDITY SENSORS

Nano porous sol gel thin film humidity sensor was studied using commercially available reference humidity sensor from Honeywell Corporation. The main advantages of our developed set up for humidity measurements is low cost and high resolution yielding a full set of information on the variation of humidity at 250°C. Humidity is considered to be one of the most effective indicators of the leakage. On this ground we developed nano porous sensor which can be used for LBB (Leak before break

Dilip Kumar Ghara, Debdulal Saha, Kamalendu Sengupta

International Journal on Smart Sensing and Intelligent Systems, Volume 1 , ISSUE 3, 784–798

Article | 30-July-2021

The effect of benzocaine and ketoprofen gels on pain during fixed orthodontic appliance treatment: a randomised, double-blind, crossover trial

, 3 and 7 days (at 18.00 hrs), using a visual analogue scale ruler (VAS, 0–4). Each patient received all three gels (benzocaine, ketoprofen, and a control (placebo)) randomly, but at three different appliance activation visits following a wash-over gap of one month. After the first day, the patients were instructed to repeat gel application twice a day at 10:00 and 18:00 hrs for three days. The recorded pain scores were subjected to non-parametric analysis. Results: The highest pain was

Ladan Eslamian, Ali Borzabadi-Farahani, Hadi Gholami

Australasian Orthodontic Journal, Volume 32 , ISSUE 1, 64–72

Article | 14-October-2020

Loss of enzyme-sensitive antigens due to the presence of leukocytes, neomycin sulfate, and LISS

the cause. Tests were performed according to the manfacturer’s instructions in MTS neutral gel cards or gel cards containing anti-IgG. We found that a reduction or loss of the Fya , Fyb , and M antigens occurs when RBCs were prepared from samples containing residual WBCs (as a source of enzymes) and subsequently incubated in media containing neomycin sulfate and LISS. We showed that the effect did not occur in the absence of neomycin sulfate. RBC antigens can be altered in LISS if they have

Randall W. Velliquette, Paula Howard, Harry Malyska, Marion E. Reid

Immunohematology, Volume 19 , ISSUE 4, 109–111

Original Paper | 28-June-2017

Molecular Study of Indigenous Bacterial Community Composition on Exposure to Soil Arsenic Concentration Gradient

Community structure of bacteria present in arsenic contaminated agricultural soil was studied with qPCR (quantitative PCR) and DGGE (Denaturing Gradient Gel Electrophoresis) as an indicator of extreme stresses. Copy number of six common bacterial taxa (Acidobacteria, Actinobacteria, α-, β- and γ-Proteobacteria, Firmicutes) was calculated using group specific primers of 16S rDNA. It revealed that soilcontaminated with low concentration of arsenic was dominated by both

Semanti Basu, Tanima Paul, Priya Yadav, Abhijit Debnath, Keka Sarkar

Polish Journal of Microbiology, Volume 66 , ISSUE 2, 209–221

Article | 14-October-2020

Equivalence of spray-dried K2EDTA,spray-dried K3EDTA, and liquid K3EDTA anticoagulated blood samples for routine blood center or transfusion service testing

(Olympus® PK 7200) and gel column methods (Ortho ID-Micro Typing System™/Gel Test™). Additional studies on blood donors’samples included time delayed antigen testing and antibody identification and half-draw/halfevacuated collections. Also, we compared the results of routine ABO/D testing and antibody screening for 50 patients’ samples collected in spray-dried K2EDTA and spray-dried K3EDTA and for an additional 50 patients’ samples collected in spray-dried K2EDTA tubes

Stacie Leathem, Nicole Dodge Zantek, Marti Kemper, Laura Korte, Al Langeberg, S. Gerald Sandler

Immunohematology, Volume 19 , ISSUE 4, 117–121

Article | 14-October-2020

MIMA-9, a valuable antibody for screening for rare donors

, McLeod, or Ge:–3 red blood cells (RBCs), was used in MTS gel cards containing anti-mouse IgG as the second antibody to test 1134 K– donors. Among the 1134 donors tested, we found one Kp(a+b–) and one Ge:–2,–3,4 donor. If random donor samples had been used instead of preselecting for K–, we would have expected to identify two K+k– donors. One reagent (MIMA-9) can be used to simultaneously screen for K+k–, Kp(a+b–), K0, McLeod, and Ge:–3 RBCs

Edith Tossas, Ragnhild Øyen, Gregory R. Halverson, Harry Malyska, Marion E. Reid

Immunohematology, Volume 18 , ISSUE 2, 43–45

Report | 01-December-2019

RHCE variant allele: RHCE*ce254G,733G

A novel RHCE allele was identified in a 53-year-old AfricanAmerican female blood donor with an Rh phenotype of D+ C– E– c+ e+ and a negative antibody screen. The donor’s cells typed e+ with all antisera tested. By gel-based genotyping and cDNA analysis, the two RHCE alleles in this donor were characterized. One allele was found to be the known allele RHCE*01.20.01 (RHCE*ce733G) and the second was novel: RHCE*01.06.02 (RHCE*ce254G,733G).

Jessica A. Keller, Trina Horn, Colleen Chiappa, Camilla Melland, Christine Vietz, Lilian Castilho, Margaret A. Keller

Immunohematology, Volume 30 , ISSUE 3, 121–122

Report | 14-March-2020

Attempts to support an immune etiology in 800 patients with direct antiglobulin test–negative hemolytic anemia

antiglobulin sera (AGS) panel of anti-IgG, anti-C3, anti-IgM, and anti-IgA by a routine DAT. Additional tests included a direct Polybrene test to detect small amounts of RBCbound IgG, a cold-wash technique to detect low-affinity IgG, and a DAT by gel test with anti-IgG. A positive result was obtained with at least one method for 431 (54%) of 800 specimens tested. The AGS panel was positive for 400 (50%) of samples, with IgG or C3 or both accounting for reactivity in 48 percent. IgA alone was found on 2

Regina M. Leger, Asuncion Co, Penny Hunt, George Garratty

Immunohematology, Volume 26 , ISSUE 4, 156–160

Article | 16-February-2021

Quality improvement with platelet additive solution for safer out-of-group platelet transfusions

the clinically relevant titer have been proposed in the United States for ABO-mismatched platelet transfusion, ranging from 20 to 500 depending on the testing method.33–41 Titers performed in tube or gel for both direct and indirect methods can differ considerably in absolute numbers but correlate strongly.4,42–45 Cooling et al.36 used titers 128–200 in a buffered gel (direct agglutination) method as a cutoff and suggested an estimated 10–20 percent of all donors should be considered to have high

M. Tynuv, W.A. Flegel

Immunohematology, Volume 35 , ISSUE 3, 108–115

Article | 03-November-2020

Use of LOR-15C9 monoclonal anti-D to differentiate erythrocytes with the partial DVI antigen from those with other partial D antigens or weak D antigens

Historically, red blood cells (RBCs) with partial D antigens have been defined serologically by their pattern of reactivity with polyclonal and monoclonal anti-D. Although numerous variants have been described in tests with well-characterized monoclonal anti-D, definition remains difficult to ascertain serologically. RBCs of known partial D type were tested with LOR-15C9 (a monoclonal anti-D) and commercial anti-D by the tube indirect antiglobulin test (IAT), by micro typing system IgG gel

Marion E. Reid, Gregory R. Halverson, Francis Roubinet, P.A. Apoil, Antoine Blancher

Immunohematology, Volume 14 , ISSUE 3, 89–93

Short Communication | 27-September-2017

Clonal Analysis of Clinical and Environmental Pseudomonas aeruginosa Isolates from Meknes Region, Morocco

From 123 clinical and environmental Pseudomonas aeruginosa isolates, 24 strains were selected for their similar antibioresistance, virulence and biofilm formation profiles, to examine their diversity and occurrence of clones within two hospitals and different natural sites in Meknes (Morocco). Pulsed-field gel electrophoresis, using DraI enzyme, didn’t reveal a close relationship between clinical and environmentalisolates nor between strains of the two hospitals. 19 genotypes were

Itto Maroui, Abouddihaj Barguigua, Asmae Aboulkacem, Hanane Elhafa, Khadija Ouarrak, Mohammed Sbiti, Lhoussain Louzi, Mohammed Timinouni, Abdelhaq Belhaj

Polish Journal of Microbiology, Volume 66 , ISSUE 3, 397–400

Article | 09-November-2020

Practical method for determination of the U status of S–s– erythrocytes

Red blood cells (RBCs) lacking S and s blood group antigens are classified as S–s–U– or S–s–U+var but the classification may vary due to the characteristics of anti-U and to the technique used. Tests on RBCs known to lack glycophorin B (GPB) or to possess an altered form of GPB showed that polyethylene glycol-indirect antiglobulin testing or MicroTyping Systems (MTS)-gel techniques can be used as a simple and reliable way to detect RBCs with variant forms of GPB

Marion E. Reid, Jill R. Storry, Joan Maurer, Sandra T. Nance

Immunohematology, Volume 13 , ISSUE 4, 111–114

Article | 17-February-2021

Identifying obstetrics patients in whom RHD genotyping can be used to assess risk of D alloimmunization

genotyping.11 This report illustrates the importance of RHD genotyping referred from a health care system comprising four separate hospitals and examines the findings of patient samples submitted for RHD genotyping due to serologic weak D phenotype or D typing discrepancy between automated gel and tube methods in the past 30 months. Materials and Methods Sample Selection Blood samples from obstetrics patients received in the four hospital blood banks from July 2013 to January 2016 were identified based

T.N. Horn, J. Keller, M.A. Keller, L. Klinger

Immunohematology, Volume 36 , ISSUE 4, 146–151

Article | 14-October-2020

Antibodies detected in samples from 21,730 pregnant women

Although anti-D is still the main cause of HDN, many other antibodies have been implicated. From September 1995 to April 2000,screening for RBC antibodies was performed on samples from 21,730 pregnant women regardless of RhD type. Standard tube and gel methods were used. Anti-D was identified in 254 samples;other antibody specificities were detected in 376 samples, for a total of 630 antibodies. For this study, 522 antibodies were considered clinically significant. The incidence of potentially

Snezana Jovanovic-Srzentic, Milan Djokic, Nenad Tijanic, Radmila Djordjevic, Nada Rizvan, Darko Plecas, Dejan Filimonovic

Immunohematology, Volume 19 , ISSUE 3, 89–92

Article | 29-December-2020

Serological and immunochemical characteristics of Ge-negative red cells and anti-Ge

Gerbich-negative red cells lack ß and Ƴ sialoglycoproteins (SGPs), which are now known to carry the Gerbich (Ge) antigens. Gerbich and Yus-type Ge-negative red cells possess distinct diffuse SGPs that migrate on sodium dodecyl sulphate polyacrylamide gel electrophoresis in a position between those normally occupied by ß and Ƴ SGPs. Both these SGPs lack Ge2 antigens and possess epitopes recognized by monoclonal anti-ß. These SGPs differ from each other in at least two

Marion E. Reid

Immunohematology, Volume 4 , ISSUE 2, 19–22

Article | 03-November-2020

Evaluation of column technology for direct antiglobulin testing

Preliminary reports have suggested that microcolumn technology might be too sensitive for direct antiglobulin testing (DAT). We studied 228 samples from patients with autoimmune diseases and 30 samples from healthy controls to determine the sensitivity of column techniques. Both Sephadex® gel and protein A/G columns were compared with manual methods using rabbit or murine polyspecific reagents. Of the 187 samples that were negative by both manual methods, an additional 29 (15%) and 42 (22

Joann M. Moulds, Laura Diekman, T. Denise Wells

Immunohematology, Volume 14 , ISSUE 4, 146–148

Article | 14-October-2020

Easy method for determining the frequency of O1 and O2 alleles in Brazilian blood donors by PCR-RFLP analysis

-out method. Different genotypes (O1O1, O1O2, O2O2) were identified after digestion with restriction enzymes KpnI, HpaII, and AluI, followed by agarose gel electrophoresis. Of 82 samples analyzed, 74 were O1O1, 7 were O1O2 , and 1 was O2O2. These results showed the frequency of O1O1 , O1O2, and O2O2 genotypes to be 90.24 percent, 8.53 percent, and 1.22 percent, respectively, in blood donors in São Paulo, Brazil.

Ana C. Batissoco, Marcia C.Z. Novaretti, Valdecir J. Bueno, Pedro E. Dorlhiac-Llacer, Dalton A.F. Chamone

Immunohematology, Volume 17 , ISSUE 4, 111–116

Research Article | 22-May-2019

GENETIC DIFFERENTIATION METHODS OF MICROORGANISMS IN THE SOIL – PLANT SYSTEM

Małgorzata Łyszcz, Anna Gałązka

Postępy Mikrobiologii - Advancements of Microbiology, Volume 56 , ISSUE 3, 341–352

Article | 03-November-2017

OPTICAL FIBER HUMIDITY SENSOR BASED ON LOSSY MODE RESONANCES

A novel optical fiber humidity sensor based on lossy mode resonances (LMR) has been developed. LMRs are supported here by a thin Indium Tin Oxide (ITO) coating fabricated onto an optical fiber core via a sol-gel dip coating. ITO coated optical fiber devices present a resonant maximum absorption peak in the infra-red region which is shifted to higher wavelengths when the refractive index of the medium in contact with the ITO layer is increased. A polymeric structure is deposited onto this ITO

M. Hernaez, C.R. Zamarreño, I. Del Villar, F.J. Arregui, I.R. Matias

International Journal on Smart Sensing and Intelligent Systems, Volume 2 , ISSUE 4, 653–660

Original Paper | 04-December-2017

Transferrin and Lactoferrin – Human Iron Sources for Enterococci

with 125I. The uptake of iron by enterococciwas determined using 59Fe labelled proteins. Reduction of iron bound to TR and LF was assayed with ferrozine. The proteolytic cleavage of TR and LF was visualized by SDS-polyacrylamide gel electrophoresis. The siderophore activity was measured with chrome azurol S. The study revealed that enterococci use several ways to acquire iron from TR and LF, such as iron chelating siderophores, iron reduction – facilitated iron release, protein degradation

Paweł Lisiecki

Polish Journal of Microbiology, Volume 66 , ISSUE 4, 419–425

Original Paper | 04-September-2018

Carbapenem-resistant Acinetobacter baumannii from Air and Patients of Intensive Care Units

To understand the molecular epidemiology and antibiotic resistance of air and clinical isolates of Acinetobacter baumannii, the intensive care unit settings of a hospital in Northern China were surveyed in 2014. Twenty non-duplicate A. baumannii isolates were obtained from patients and five isolates of airborne A. baumannii were obtained from the wards’ corridors. Pulsed field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) were used to analyze the homology relationships of

MEIJIE JIANG, YUNQING MU, NING LI, ZHIJUN ZHANG, SHULIN HAN

Polish Journal of Microbiology, Volume 67 , ISSUE 3, 333–338

Article | 14-October-2020

The investigation of the significance of a positive direct antiglobulin test in blood donors

Sixty-two samples from 62 donors were investigated to determine the significance of warm IgG autoantibodies that were detected using a gel system during compatibility testing. The presence of autoantibodies on the red cells was confirmed by elution studies. Twelve of 23 strongly positive samples, 7 of 19 moderately positive samples, and 6 of 11 weakly positive samples were studied. The remaining nine samples were found positive during crossmatching, then negative when it was repeated.These nine

Marianna Bellia, John Georgopoulos, Vasilis Tsevrenis, Efrosini Nomikou, Niki Vgontza, I. Kontogpoulous-Griva

Immunohematology, Volume 18 , ISSUE 3, 78–81

Case report | 26-October-2019

Blocked D phenomenon and relevance of maternal  serologic testing

A blood requisition for double-volume exchange transfusion was received for a 2-day-old male child born to a 29-yearold multiparous female (P2002) referred to our institute having neonatal jaundice with encephalopathy; no maternal sample was received. The neonatal blood sample was typed as group A, D–, and the direct antiglobulin test (DAT) was strongly positive (4+) using the gel method. Mono-specific DAT showed the presence of IgG antibodies on neonatal red blood cells (RBCs). Acid

Ashish Jain, Vijay Kumawat, Neelam Marwaha

Immunohematology, Volume 31 , ISSUE 3, 116–118

Original Paper | 28-December-2016

Gas Gangrene of Different Origin Associated with Clostridium perfringens Type A in Three Patients Simultaneously Hospitalized in a Single Department of Orthopedics and Traumatology in Poland

April 2015 and 20th April 2015. The three C. perfrin­gens isolates studied had identical biochemical profiles. Two isolates had identical resistance patterns, while the third presented a different profile. Using the multiplex PCR method, all isolates showed the presence of cpa gene encoding α-toxin; furthermore, the presence of the cpb2 gene encoding β2-toxin was confirmed in two isolates. Genotyping with the use of pulsed field gel electrophoresis (PFGE) indicated that the isolates

Monika Brzychczy-Włoch, Dorota Ochońska, Anna Piotrowska, Małgorzata Bulanda

Polish Journal of Microbiology, Volume 65 , ISSUE 4, 399–406

Article | 03-November-2020

Comparison of affinity column technology and LISS tube tests

, the antibodies become attached to the RBC surface. When the microcolumns are centrifuged, the RBCs pass through a viscous barrier into an active matrix containing proteins G and A. Positive tests adhere at the top of the gel and negative tests pass through, settling to the bottom. This study was undertaken to compare affinity column technology with low-ionic saline solution (LISS) tube tests in a reference laboratory setting. Over a 1-year period, 314 samples were tested in parallel by affinity

Kayla D. Champagne, Peggy Spruell, Jane Chen, Leslie Voll, Gloria Schlanser, Marilyn Moulds

Immunohematology, Volume 14 , ISSUE 4, 149–151

Report | 09-October-2019

Trends of ABO and Rh phenotypes in transfusion-dependent patients in Pakistan

The objective of this study was to determine the prevalence of ABO and Rh phenotypes in the general Pakistan population. This information could be used to help reduce the rate of alloimmunization in patients with blood disorders, such as thalassemia major, who require frequent blood transfusions. A total of 242 patients with blood disorders requiring frequent blood transfusions were enrolled in the study. ABO and Rh typing was performed on samples from these patients using tube and gel methods

Nida Anwar, Munira Borhany, Saqib Ansari, Sana Khurram, Uzma Zaidi, Imran Naseer, Muhammad Nadeem, Tahir Shamsi

Immunohematology, Volume 32 , ISSUE 4, 170–173

Review | 09-October-2019

How to recognize and resolve reagentdependent reactivity: a review

Gavin C. Patch, Charles F. Hutchinson, Nancy A. Lang, Ghada Khalife

Immunohematology, Volume 32 , ISSUE 3, 96–99

Article | 18-October-2020

From kill to overkill: 100 years of (perhaps too much) progress

Peter D. Issitt

Immunohematology, Volume 16 , ISSUE 1, 18–25

Original Paper | 26-August-2016

Characterization of a Highly Enriched Microbial Consortium Reductively Dechlorinating 2,3-Dichlorophenol and 2,4,6-Trichlorophenol and the Corresponding cprA Genes from River Sediment

acceptors. When acetate, formate, or pyru­vate were used as electron donors, dechlorination activity was lost. Only lactate can replace dihydrogen as an electron donor. However, the dechlorination potential was decreased after successive transfers. To reveal chlororespiring species, the microbial community structure of chlorophenol-reductive dechlorinating enrichment cultures was analyzed by PCR-denaturing gradient gel electrophoresis (DGGE) of 16S rRNA gene fragments. Eight dominant bacteria were

Wael S. El-Sayed

Polish Journal of Microbiology, Volume 65 , ISSUE 3, 341–352

original-paper | 03-September-2019

Evidence for Infections by the Same Strain of Beta 2-toxigenic Clostridium perfringens Type A Acquired in One Hospital Ward

the Gel-Compar II (Applied Maths) software with the application of UPGMA clustering method and Jaccard index. The obtained genetic profiles were interpreted according to the guidelines given by van (Belkum et al. 2007). The profiles of the strains under investigation that were obtained using PCR multiplex and PFGE were compared with restriction patterns of the strains that came from the event in 2015, when in the Orthopedics and Traumatology Department of the same hospital, three cases of gas

DOMINIKA SALAMON, DOROTA OCHOŃSKA, ILONA WOJAK, EWA MIKOŁAJCZYK, MAŁGORZATA BULANDA, MONIKA BRZYCHCZY-WŁOCH

Polish Journal of Microbiology, Volume 68 , ISSUE 3, 323–329

original-paper | 18-February-2020

Assessing the Microbial Communities in Four Different Daqus by Using PCR-DGGE, PLFA, and Biolog Analyses

rise to distinctive flavors. In the past, culture-dependent methods were the commonest approach to microbial profiling analysis. However, microorganisms identified using these methods amount to ≤ 10% of the total environmental microorganisms and do not reflect the actual microbial profile distribution within Daqu (Liu et al. 2017). Culture-independent methods such as polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) analysis are highly useful to detect the whole microbial

YUXI LING, WENYING LI, TONG TONG, ZUMING LI, QIAN LI, ZHIHUI BAI, GUIJUN WANG, JIAHAO CHEN, YUGUANG WANG

Polish Journal of Microbiology, Volume 69 , ISSUE 1, 27–37

Article | 15-August-2021

Shear bond strength of different fixed orthodontic retainers

Objective: To compare the shear bond strength of different fixed retainer wire diameters bonded using a conventional composite resin or a specific retainer composite. Materials and methods: One-hundred-and-twenty extracted human premolar teeth were divided into six groups. After conventional acid etching with a 37% phosphoric acid gel for 30 seconds, twist flex wires of various diameters (0.0175”, 0.0215”, 0.032”) were bonded as fixed retainers. Conventional bracket adhesive

Kazem Al-Nimri, Jareer Al-Nimri

Australasian Orthodontic Journal, Volume 31 , ISSUE 2, 178–183

original-paper | 19-March-2021

Clonal Dissemination of KPC-2, VIM-1, OXA-48-Producing Klebsiella pneumoniae ST147 in Katowice, Poland

using the Pulsed Field Gel Electrophoresis (PFGE) method, following genomic DNA extraction and digestion with XbaI endonuclease (Fermentas, Lithuania), as described previously (Han et al. 2013). Salmonella enterica subsp. enterica serovar Braenderup strain H9812 (ATCC® BAA664™) and K. pneumoniae ATCC® BAA-1705™ were used as reference markers. PFGE banding patterns were compared using BioNumerics v.6.5 (Applied Maths, Belgium) software. The relatedness was determined by the unweighted pair group

DOROTA OCHOŃSKA, HANNA KLAMIŃSKA-CEBULA, ANNA DOBRUT, MAŁGORZATA BULANDA, MONIKA BRZYCHCZY-WŁOCH

Polish Journal of Microbiology, Volume 70 , ISSUE 1, 107–116

Report | 26-October-2019

Clinical and reference lab characteristics of patients with suspected direct antiglobulin test (DAT)-negative immune hemolytic anemia

patient samples for an enhanced DAT evaluation from January 2011 through June 2013. An enhanced DAT evaluation involved a standard DAT and DATs performed using gel, polyethylene glycol, and 4°C low-ionic strength saline wash. We obtained detailed clinical information from 57 patients with an enhanced DAT investigation. Eighteen of these 57 patients (31.6%) were found to have a positive DAT, 11 (19.3%) of which were found to have a positive enhanced DAT (2 were positive by enhanced methods and

Matthew S. Karafin, Gregory A. Denomme, Michael Schanen, Jerome L. Gottschall

Immunohematology, Volume 31 , ISSUE 3, 108–115

Article | 20-July-2021

Mandibular repositioning in adult patients – an alternative to surgery? A two-year follow-up

, initial records, lateral and frontal head films, study casts and photos were obtained (T0) and the mandible was repositioned to camouflage a retrognathic skeletal discrepancy or a mandibular transverse asymmetry by means of an occlusal build-up using Triad™ gel. Results: Three months later (T1), 23 patients had adapted to the new occlusion reflected by an absence of functional disturbance and without fracture of the composite occlusal build-up. Mandibular position in these patients was

Giorgio Fiorelli, Paola Merlo, Michel Dalstra, Birte Melsen

Australasian Orthodontic Journal, Volume 35 , ISSUE 1, 61–70

research-article | 30-November-2020

The impact of chemical nematicides on entomopathogenic nematode survival and infectivity

several hours (Lewis, 2002, Lewis et al., 2006). Pluronic F-127 (Sigma-Aldrich, Germany) was used as the substrate. First, 28.75% (w/v) aqueous Pluronic F-127 gel medium was prepared by dissolving powdered gel in 100 ml distilled water and incubating mixture at 5°C overnight. Then, 2.5 ml of prepared gel was poured on microscope slides (2.5 × 7.5 cm), which were divided into three equal zones (Z1, Z2, and Z3), and allowed to solidify (Hummadia et al., 2021; Wang et al., 2009). The substrate was

Mustapha Touray, Harun Cimen, Sebnem H. Gulsen, Derya Ulug, Dolunay Erdogus, David Shapiro-Ilan, Selcuk Hazir

Journal of Nematology, Volume 53 , 1–17

Research Article | 17-October-2018

First Report of Stubby-Root Nematode, Paratrichodorus minor, on Onion in Georgia, U.S.A

segments of 28S rRNA, and ITS1 rDNA were amplified using primer pairs 360F (5′ CTACCACATCCAAGGAAGGC 3′)/932R (5′ TATCTGATCGCTGTCGAACC 3′), D2A (5′ ACAAGTACCGTGAGGGAAAGTTG 3′)/D3B (5′ TCGGAAGGAACCAGCTACTA 3′), and BL18 (5′ CCCGTCGCTACTACCGATT 3′)/5818 (5′ ACGARCCGAGTGATCCAC 3′), respectively (Riga et al., 2007; Duarte et al., 2010; Ye et al., 2015; Shaver et al., 2016). The obtained PCR fragments were purified using QIAquick Gel Extraction Kit (Qiagen Inc., Santa Clara, CA, USA), sequenced and deposited

Abolfazl Hajihassani, Negin Hamidi, Bhabesh Dutta, Chris Tyson

Journal of Nematology, Volume 50 , ISSUE 3, 453–455

No Record Found..
Page Actions