Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Letter to the Editor
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • critical-appraisal
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • non-scientific
  • Obituary
  • original-paper
  • original-report
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • review-paper
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • short-communication
  • short-report
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • Journal Of Nematology

 

research-article | 30-November-2018

Morphological and Molecular Characterization of Coslenchus paramaritus n. sp. and C. cancellatus (Cobb, 1925) Siddiqi, 1978 (Nematoda: Tylenchidae) from Iran

microscope eye-piece camera in conjunction with its Dino Capture version 2.0 software. Specimens were identified at species level using available identification keys (Geraert, 2008). DNA extraction, PCR and sequencing Nematode DNA was extracted from single individuals and stored at −20°C until used as PCR template. DNA extraction was performed using the protocols described by Tanha Maafi et al. (2003). The D2–D3 expansion fragments of 28S rRNA were amplified using the forward D2A (5

Manouchehr Hosseinvand, Ali Eskandari, Reza Ghaderi

journal of nematology, Volume 51 , 1–10

research-article | 30-November-2020

First report and new molecular and morphological characterizations of root-knot nematode, Meloidogyne javanica, infecting ginger and long coriander in Vietnam

slides following Nguyen et al. (2019). For morphological characterization, measurements and pictures were taken from permanent slides using Carl Zeiss Axio Lab. A1 light microscope equipped with a Zeiss Axiocam ERc5s digital camera. For molecular characterization, Multiplex-PCR using primers Mi2F4/Mi2R1, Far/Rar, and Fjav/Rjav was performed following Kiewnick et al. (2013) to quickly identify M. javanica from closely related species in the tropical root-knot nematode group. The D2-D3 region of 28S

Ke Long Phan, Thi Mai Linh LE, Huu Tien Nguyen, Thi Duyen Nguyen, Quang Phap Trinh

Journal of Nematology, Volume 53 , 1–8

research-article | 30-November-2019

Molecular characterization of the Pratylenchus vulnus populations on cereals in Turkey

Vovlas, 2007). Molecular techniques as RAPD-PCR and sequencing of D2 to D3 expansion segments of the 28S rRNA was used for the identification of P. vulnus on different plant species (Subbotin et al., 2008; Bakooie et al., 2012; Lopez-Nicora et al., 2012). Moreover, real-time PCR provides sensitive identification of the species with species-specific primers using 1/128 of the DNA of one nematode (Huang and Yan, 2017). Pratylenchus vulnus (Allen and Jensen, 1951) (walnut root lesion nematode) has been

Mehmet Sait Karaca, Elif Yavuzaslanoglu, Gul Imriz, Ozlem Ates Sonmezoglu

Journal of Nematology, Volume 52 , 1–4

research-article | 30-November-2020

Morphological and molecular characterization of Xiphinemella esseri Chitwood, 1957 (Dorylaimida: Leptonchidae) from Florida, with the first molecular study of the genus

250D digital camera (Canon, Tokyo, Japan). Digital images were edited using Adobe® Photoshop® CS (Adobe Systems, San Jose, CA). DNA extraction, PCR, sequencing, and phylogenetic analysis DNA was extracted from single individuals using the proteinase K protocol. DNA extraction, PCR, and cloning protocols were used as described by Tanha Maafi et al. (2003). The primers used for amplification of the D2-D3 expansion segments of 28S rRNA gene were the D2A (5′-ACA AGT ACC GTG AGG GAA AGT TG-3′) and the

Sergio Álvarez-Ortega, Sergei A. Subbotin, Renato N. Inserra

Journal of Nematology, Volume 53 , 1–9

research-article | 25-May-2020

Description and molecular phylogeny of Mesocriconema abolafiai n. sp. (Nematoda: Criconematidae) from Iran

For DNA amplification the protocol described by Tanha Maafi et al. (2003) was used. The D2 to D3 expansion regions of the 28S rRNA gene was amplified with the forward D2A (5´-ACAAGTACCGTGAGGGAAAGTTG-3´) and the reverse D3B (5´-TCGGAAGGAACCAGCTACTA-3´) primers (Nunn, 1992). The 18S rRNA was amplified as two partially overlapping fragments, using three universal and one nematode-specific primer (1912R). First 18S fragment forward primer 988F (5´-CTCAAAGATTAAGCCATGC-3´) and reverse primer 1912R (5

Hossein Mirbabaei Karani, Ali Eskandari, Reza Ghaderi, Akbar Karegar

Journal of Nematology, Volume 52 , 1–17

research-article | 30-November-2020

Morphological and molecular characterisation of Longidorus pauli (Nematoda: Longidoridae), first report from Greece

objective of the present study was to provide an accurate identification of Longidorus species detected in North Greece by an integrative approach of morphological and molecular characterization by using the D2-D3 expansion segments of 28S rRNA, ITS1 rRNA, and partial mitochondrial coxI regions. Materials and methods Nematode samples and morphological study Soil samples were collected at a depth of 20 to 40 cm from the rhizosphere of a grapevine grafted on 1103-Paulsen of the Institute of Plant

Emmanuel A. Tzortzakakis, Ilenia Clavero-Camacho, Carolina Cantalapiedra-Navarrete, Parthenopi Ralli, Juan E. Palomares-Rius, Pablo Castillo, Antonio Archidona-Yuste

Journal of Nematology, Volume 53 , 1–10

Article | 21-July-2017

Molecular and Morphological Characterization of Xiphinema chambersi Population from Live Oak in Jekyll Island, Georgia, with Comments on Morphometric Variations

rounded and set off from head; total stylet length 170 to 193 mm; vulva at 20.4% to 21.8% of body length; a monodelphic, posterior reproductive system; elongate, conoid tail with a blunt terminus and four pairs of caudal pores, of which two pairs are subdorsal and two subventral. Sequence data from the D2–D3 region of the 28S rRNA molecule subjected to GenBank sequence comparison using BLAST showed that the sequence had 96% and 99% similarity with X. chambersi from Alabama

ZAFAR A. HANDOO, LYNN K. CARTA, ANDREA M. SKANTAR, SERGEI A. SUBBOTIN, STEPHEN W. FRAEDRICH

Journal of Nematology, Volume 48 , ISSUE 1, 20–27

research-article | 06-November-2020

Morphological and molecular analyses of a Meloidogyne mali population with high intragenomic rRNA polymorphism

ITS, respectively. In 28S phylogenetic tree, M. mali was sister to an unidentified Chinese Meloidogyne population forming a fully supported clade (PP = 1), while in ITS, it was sister to M. oleae Archidona-Yuste, Cantalapiedra-Navarrete, Liébanas, Rapoport, Castillo and Palomares-Rius, 2018 in a weakly supported clade (PP = 0.58) and showed an unresolved mitochondrial COI phylogenetic tree (Figs. 3-5). A total of 17 clones from four specimens were sequenced for 28S rRNA, and analysis of acquired

Jianfeng Gu, Yiwu Fang, Lele Liu

Journal of Nematology, Volume 52 , 1–11

Research Article | 17-October-2018

First Report of Bitylenchus hispaniensis, Pratylenchoides alkani, and Helicotylenchus vulgaris in Association with Cultivated and Wild Olives in Crete, Greece and Molecular Identification of Helicotylenchus microlobus and Merlinius brevidens

Emmanuel A. Tzortzakakis, Carolina Cantalapiedra-Navarrete, Maria Kormpi, Maria S. Lazanaki, Pablo Castillo, Antonio Archidona-Yuste

Journal of Nematology, Volume 50 , ISSUE 3, 413–418

research-article | 27-May-2019

First report of the dagger nematode Xiphinema pachtaicum on onion in Morocco

and yellowing of leaves. To confirm the identity of X. pachtaicum, DNA was extracted from single females (n = 2) by using the protocol described by Holterman et al. (2006). Two primers were used: forward D2a (5′ ACAAGTACCGTGAGGGAAAGTTG 3′) and reverse D3b (5′ TGCGAAGGAACCAGCTACTA 3′) for the amplification of the D2D3 region of 28S rRNA (Nunn, 1992). The PCR products (represented by accession Nos. MK622911 and MK622912) were sequenced, aligned and compared with published sequences by means of

Fouad Mokrini, Abdelfattah Dababat

Journal of Nematology, Volume 51 , 1–2

research-article | 24-April-2020

Mitochondrial COI gene is valid to delimitate Tylenchidae (Nematoda: Tylenchomorpha) species

sequences for the identification of Tylenchidae species; and compare the resolution, sequences variability, and tree topologies obtained from one COI and two rRNA markers (i.e. 18S and the 28S rRNA). Materials and methods Samples collection and processing Soil samples were collected in China from 2018 to 2019. The details on sampling locations and habitats were given in Table 1. The nematodes were extracted from soil samples by Baermann tray and subsequently collected by a 400 mesh sieve (37 μm

Mengxin Bai, Xue Qing, Kaikai Qiao, Xulan Ning, Shun Xiao, Xi Cheng, Guokun Liu

Journal of Nematology, Volume 52 , 1–12

research-article | 31-August-2020

First report of potato rot nematode, Ditylenchus destructor Thorne, 1945 infecting Codonopsis pilosula in Gansu province, China

Chunhui Ni, Shuling Zhang, Huixia Li, Yonggang Liu, Wenhao Li, Xuefen Xu, Zhipeng Xu

Journal of Nematology, Volume 52 , 1–2

research-article | 03-June-2019

Morphological and molecular characterization of Labronema montanum sp. n. (Dorylaimida, Dorylaimidae) from Spain

final volume of 25 μl. The primers used for amplification of the D2-D3 region of 28S rRNA gene were the D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and the D3B (5′-TCGGAAGGAACCAGCTACTA-3′) primers (De Ley et al., 1999). PCR cycle conditions were as follows: one cycle of 94°C for 3 min, followed by 35 cycles of 94°C for 1 min + annealing temperature of 55°C for 45 s + 72°C for 2 min, and finally one cycle of 72°C for 10 min. After DNA amplification, 5 μl of product was loaded on a 1% agarose gel in 0.5% Tris

R. Peña-Santiago, J. Abolafia

Journal of Nematology, Volume 51 , 1–11

research-article | 30-November-2019

Characterization of a population of Pelodera strongyloides (Nematoda: Rhabditidae) associated with the beetle Lucanus ibericus (Coleoptera: Lucanidae) from Georgia

. In the present study, a Georgian population of P. strongyloides recovered for the first time from L. ibericus and was fully characterized by morphology and morphometrics. Furthermore, the PCR amplification and sequencing of the D2 to D3 expansion domains of the 28S rRNA gene, the ITS, and the mitochondrial COI were carried out. The phylogenetic relationships of P. strongyloides from Georgia to other Pelodera species and Rhabditidae were also reconstructed. Materials and methods Nematode

O. Gorgadze, A. Troccoli, E. Fanelli, E. Tarasco, F. De Luca

Journal of Nematology, Volume 52 , 1–12

research-article | 06-November-2020

Morphological and molecular characterization of Epidorylaimus procerus sp. n. (Dorylaimida: Qudsianematidae) from Vietnam

). From the Russian species E. rivalis, it differs in being longer (2.16-2.46 vs 1.46-2.29 mm, n = 15), the lip region is less differentiated (weak vs deep constriction), and it has a longer odontostyle (32-35 vs 28-30 µm). Males of E. rivalis are as abundant as females, whereas they are unknown in E. procerus n. sp. and thus likely to be rare or absent. Evolutionary relationships, as derived from the analysis of D2-D3 28S-rRNA gene sequences, are presented in a molecular tree (Fig. 3). The new

Thi Anh Duong Nguyen, Reyes Peña-Santiago

Journal of Nematology, Volume 52 , 1–8

Research Article | 03-September-2018

Nothotylenchus andrassy n. sp. (Nematoda: Anguinidae) from Northern Iran

anus distance); and elongate, conical tail with pointed tip. Nothotylenchus andrassy n. sp. is morphologically similar to five known species of the genus, namely Nothotylenchus geraerti, Nothotylenchus medians, Nothotylenchus affinis, Nothotylenchus buckleyi, and Nothotylenchus persicus. The results of molecular analysis of rRNA gene sequences, including the D2–D3 expansion region of 28S rRNA, internal transcribed spacer (ITS) rRNA and partial 18S rRNA gene are provide for the new species.

Parisa Jalalinasab, Mohsen Nassaj Hosseini, Ramin Heydari

Journal of Nematology, Volume 50 , ISSUE 2, 219–228

Research Article | 17-October-2018

Characterization of Meloidogyne indica (Nematoda: Meloidogynidae) Parasitizing Neem in India, with a Molecular Phylogeny of the Species

juveniles, males and females were carried out by light compound and scanning electron microscopy. Gross morphology and measurements were found consistent with the original description of M. indica infecting citrus by Whitehead (1968). The neem population was found to infect and reproduce on citrus. Additionally, evolutionary relationship was deduced by Maximum likelihood method using ITS rRNA, D2D3 expansion segment of 28S rRNA and mitochondrial COI sequences. Phylogenetic analyses based on these

Victor Phani, Satyapal Bishnoi, Amita Sharma, Keith G. Davies, Uma Rao

Journal of Nematology, Volume 50 , ISSUE 3, 387–398

Research Article | 03-December-2018

First report of Pratylenchus vulnus associated with apple in Tunisia

. Microscopic observation of females and males demonstrated the occurrence of Pratylenchusd vulnus on apple trees. The ribosomal DNA D2-D3 expansion segments of the 28S rRNA and of the Pratylenchus populations were PCR amplified and sequenced. The sequences were compared with those of Pratylenchus species in the GenBank database with high similarity (99%). This comparison reconfirmed the morphological identifications. Phylogenetic studies placed those populations with P. vulnus. This is the first report of

Noura Chihani-Hammas, Lobna Hajji-Hedfi, Hajer Regaieg, Asma Larayedh, Ahmed Badiss, Yu Qing, Horrigue-Raouani Najet

Journal of Nematology, Volume 50 , ISSUE 4, 579–586

research-article | 30-November-2020

Report of the Texas peanut root-knot nematode, Meloidogyne haplanaria (Tylenchida: Meloidogynidae) from American pitcher plants (Sarracenia sp.) in California

Olympus BX51 microscope equipped with Nomarski interference contrast. Molecular analysis of nematode samples DNA was extracted from several J2 specimens using the proteinase K protocol. DNA extraction and PCR protocols were as described by Janssen et al. (2016) and Subbotin (2021a). The following primer sets were used in this study: D2A (5′-ACA AGT ACC GTG AGG GAA AGT TG-3′) and D3B (5′-TCG GAA GGA ACC AGC TAC TA-3′) amplifying the D2-D3 expansion segments of 28S rRNA gene, TW81 (5′-GTT TCC GTA GGT

Sergei A. Subbotin

Journal of Nematology, Volume 53 , 1–7

Article | 21-July-2017

Paurodontella parapitica n. sp. (Nematoda: Hexatylina, Sphaerularioidea) from Kermanshah Province, Western Iran

inner incisures weakly crenated, excretory pore situated 90 to 100 mmfrom anterior end; functional males common in the population, with spicules 24 to 26 mmlong. Tail of both sexes similar, almost straight and elongate-conoid. The new species resembles in morphology and morphometrics to four known species of the genus, namely P. apitica, P. minuta, P. myceliophaga, and P. sohailai. The results of phylogenetic analyses based on sequences of D2/D3 expansion region of 28S rRNA gene

MEHRAB ESMAEILI, RAMIN HEYDARI, WEIMIN YE

Journal of Nematology, Volume 48 , ISSUE 2, 109–115

research-article | 30-November-2019

Description of Deladenus gilanica n. sp. (Hexatylina: Neotylenchidae) isolated from wood of black pine in Northern Iran

extracts were stored at −20°C until used as template for PCR amplification. The D2/D3 expansion segment of 28S rRNA gene was amplified using the forward D2A (5´–ACAAGTACCGTGAGGGAAAGTTG–3´) and reverse D3B (5´–TCGGAAGGAACCAGCTACTA–3´) primers (Nunn, 1992) and the partial 18S was amplified using primers 1096F (5´–GGTAATTCTGGAGCTAATAC-3´) and 1912R (5´–TTTACG GTCAGAACTAGGG–3´) (Holterman et al., 2006). PCR cycle conditions for all rDNA regions were as follows: one cycle of 94°C for 2 min, followed by 35

Parisa Jalalinasab, Mehrab Esmaeili, Weimin Ye, Ramin Heydari

Journal of Nematology, Volume 52 , 1–10

research-article | 30-November-2019

Aphelenchus yinyuensis n. sp. (Tylenchina: Aphelenchoididae) found in Terminalia sp. in China

Gu Jianfeng, Munawar Maria, Yiwu Fang, Liu Lele, Xianfeng Chen, Bo Cai

Journal of Nematology, Volume 52 , 1–12

Research Article | 26-September-2018

First Reports, Morphological, and Molecular Characterization of Longidorus caespiticola and Longidorus poessneckensis (Nematoda: Longidoridae) from Ukraine

processed to glycerol and mounted on permanent slides and subsequently identified morphologically and molecularly. Nematode DNA was extracted from single individuals and PCR assays were conducted as previously described for D2–D3 expansion segments of 28S rRNA. Sequence alignments for D2–D3 from L. caespiticola showed 97%–99% similarity to other sequences of L. caespiticola deposited in GenBank from Belgium, Bulgaria, Czech Republic, Russia, Slovenia, and Scotland. Similarly, D2–D3 sequence alignments

SOLOMIA SUSULOVSKA, PABLO CASTILLO, ANTONIO ARCHIDONA-YUSTE

Journal of Nematology, Volume 49 , ISSUE 4, 396–402

research-article | 17-March-2020

Characterization of root-knot nematodes infecting mulberry in Southern China

%) to sequences of Meloidogyne enterolobii. The phylogenetic tree inferred from rDNA-ITS (Fig. 2) suggests that MK850135, MN102393, and Meloidogyne enterolobii (KX823381.1 and KX823382.1) are in the monophyletic clade, while MK850136, MK850137, MK850138, and MK116406 are in another monophyletic clade in relation to a population of Meloidogyne enterolobii (KX823381.1 and KX823382.1). The phylogenetic tree inferred from the D2-D3 region of the 28S rRNA (Fig. 3) indicated that MN01721, MN01724

Pan Zhang, Hudie Shao, Chunping You, Yan Feng, Zhenwen Xie

Journal of Nematology, Volume 52 , 1–8

research-article | 30-November-2020

First report of northern root-knot nematode, Meloidogyne hapla (Chitwood, 1949) on strawberry in Turkey

PCR was conducted with the general primers D2\D3 that encode 28S rRNA gene region and PCR products were sequenced. Figure 1: Damage of Meloidogyne hapla on strawberry roots. Results Morphological and molecular identification of the nematode This study was conducted to determine the species of root-knot nematode that causes galls of various sizes on strawberry roots. The inoculated strawberry plants exhibited typical galling on roots. Koch’s postulates were confirmed by re-isolating the

Adem Özarslandan, Dilek Dinçer, Şefika Yavuz, Ayşenur Aslan

Journal of Nematology, Volume 53 , 1–4

research-article | 11-January-2021

On the molecular identity of Paratylenchus nanus Cobb, 1923 (Nematoda: Tylenchida)

Sergei A. Subbotin, Guiping Yan, Mihail Kantor, Zafar Handoo

Journal of Nematology, Volume 52 , 1–7

research-article | 30-November-2020

Morphological and molecular characterization of Paratylenchus beltsvillensis n. sp. (Tylenchida: Paratylenchidae) from the rhizosphere of pine tree (Pinus virginiana Mill) in Maryland, USA

several Paratylenchus species using partial 28S rRNA gene sequences. Lopez et al. (2013) used the ITS1 rRNA gene to reconstruct paratylenchid relationships including G. bilineata Brzeski (1995) and G. aculenta (Brown, 1959; Raski, 1962). Van Den Berg et al. (2014) inferred phylogenetic relationships among several Paratylenchus spp. using 28S rRNA (58 sequences) and ITS rRNA (40 sequences) gene sequences for this genus. Wang et al. (2016a), also using the ITS rRNA gene, demonstrated that their newly

Mihail R. Kantor, Zafar A. Handoo, Sergei A. Subbotin, Gary R. Bauchan, Joseph D. Mowery

Journal of Nematology, Volume 53 , 1–10

research-article | 11-March-2021

Morphology, development stages, and phylogeny of the Rhabditolaimus ulmi (Nematoda: Diplogastridae), a phoront of the bark beetle Scolytus multistriatus from the elm Ulmus glabra Huds. in Northwest Russia

pooled nematodes using proteinase K. PCR and sequencing protocols were as described by Tanha Maafi et al. (2003). The forward Rhabditolaimus_D2A-1 – (5′-GGC GAA GCG GAT AGA GTT GAC-3′) and reverse D3B (5′-TCG GAA GGA ACC AGC TAC TA-3′) primers were used for amplification of the D2-D3 expansion segments of 28S rRNA gene. Sequencing was done at Genewiz., Inc (CA, USA). A sequence was deposited in GenBank under the accession number: MW044951. The D2-D3 expansion segments of 28S rRNA gene sequence of R

Alexander Y. Ryss, Kristina S. Polyanina, Sergio Álvarez-Ortega, Sergei A. Subbotin

Journal of Nematology, Volume 53 , 1–25

Research Article | 17-October-2018

First Report of Stubby-Root Nematode, Paratrichodorus minor, on Onion in Georgia, U.S.A

segments of 28S rRNA, and ITS1 rDNA were amplified using primer pairs 360F (5′ CTACCACATCCAAGGAAGGC 3′)/932R (5′ TATCTGATCGCTGTCGAACC 3′), D2A (5′ ACAAGTACCGTGAGGGAAAGTTG 3′)/D3B (5′ TCGGAAGGAACCAGCTACTA 3′), and BL18 (5′ CCCGTCGCTACTACCGATT 3′)/5818 (5′ ACGARCCGAGTGATCCAC 3′), respectively (Riga et al., 2007; Duarte et al., 2010; Ye et al., 2015; Shaver et al., 2016). The obtained PCR fragments were purified using QIAquick Gel Extraction Kit (Qiagen Inc., Santa Clara, CA, USA), sequenced and deposited

Abolfazl Hajihassani, Negin Hamidi, Bhabesh Dutta, Chris Tyson

Journal of Nematology, Volume 50 , ISSUE 3, 453–455

research-article | 30-November-2018

Meloidogyne aegracyperi n. sp. (Nematoda: Meloidogynidae), a root-knot nematode parasitizing yellow and purple nutsedge in New Mexico

MRG YGA TYA GAT ACC GCY PCR 18S rRNA 1629 R deg GGT GTG TAC AAA KSR CAG GGA PCR 18S rRNA 79 F deg GDG AAACYG CGWACG GCT PCR 18S rRNA RKN-5R TCG AAC ATG TCA AAA GGA GC PCR and sequencing HSP90 RKN-d1F GCY GAT CTT GTY AAC AAC CYT GGA AC PCR and sequencing HSP90 For the amplification of the D2-D3 region of the 28S rRNA, the forward D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and the reverse D3B (5′-TCGGAAGGAACCAGCTACTA-3′) primers were used (De Ley et al., 1999). For amplification of the ITS1

J. D. Eisenback, L. A. Holland, J. Schroeder, S. H. Thomas, J. M. Beacham, S. F. Hanson, V. S. Paes-Takahashi, P. Vieira

journal of nematology, Volume 51 , 1–16

No Record Found..
Page Actions