Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Letter to the Editor
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • critical-appraisal
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • non-scientific
  • Obituary
  • original-paper
  • original-report
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • review-paper
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • short-communication
  • short-report
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • Journal Of Nematology

 

research-article | 30-November-2018

A COI DNA barcoding survey of Pratylenchus species in the Great Plains Region of North America

. scribneri in corn fields of Iowa (Norton, 1983). Todd et al. (2014) reported P. neglectus and P. thornei Sher & Allen, 1953 in wheat fields of Kansas and Colorado. This accounting of Pratylenchus species reported from the Great Plains region totals nine different species, not including P. agilis. The objectives of this study were to (i) barcode Pratylenchus specimens for species identification across the Great Plains region using the cytochrome oxidase subunit 1 (COI) gene of the mitochondrial DNA

Mehmet Ozbayrak, Tim Todd, Timothy Harris, Rebecca Higgins, Kirsten Powers, Peter Mullin, Lisa Sutton, Thomas Powers

Journal of Nematology, Volume 51 , 1–21

research-article | 24-April-2020

Mitochondrial COI gene is valid to delimitate Tylenchidae (Nematoda: Tylenchomorpha) species

et al., 2006; Subbotin et al., 2006). However, rRNA genes are problematic in Tylenchidae phylogeny and the unresolved status is unlikely to be improved by intensive species sampling (Qing et al., 2017; Qing and Bert, 2019). Therefore, finding a proper molecular marker gene is crucial for the Tylenchidae study. In this study we examined the mitochondrial Cytochrome Oxidase I gene (COI) of 12 species belong to Tylenchidae (sensu (Geraert, 2008)), the goal is to evaluate the potential of COI

Mengxin Bai, Xue Qing, Kaikai Qiao, Xulan Ning, Shun Xiao, Xi Cheng, Guokun Liu

Journal of Nematology, Volume 52 , 1–12

research-article | 24-April-2019

DNA barcoding evidence for the North American presence of alfalfa cyst nematode, Heterodera medicaginis

alfalfa (https://nematode.unl.edu/hetemedic.htm) in the Great Plains state of Kansas in the US. A follow-up of these reports, utilizing morphology, host trials, and DNA barcoding using the mitochondrial gene COI along with ITS1, the transcribed spacer region between 18S and 5.8S of the nuclear ribosomal repeat region, and the heat shock protein gene Hsp90 provide supporting evidence that Heterodera medicaginis is present in the US. Materials and methods Nematode collections The original North

Thomas Powers, Andrea Skantar, Tim Harris, Rebecca Higgins, Peter Mullin, Saad Hafez, Zafar Handoo, Tim Todd, Kirsten Powers

Journal of Nematology, Volume 51 , 1–17

Research Article | 17-October-2018

Discovery and Identification of Meloidogyne Species Using COI DNA Barcoding

Thomas Powers, Timothy Harris, Rebecca Higgins, Peter Mullin, Kirsten Powers

Journal of Nematology, Volume 50 , ISSUE 3, 399–412

research-article | 30-November-2020

Genetic variation within a species of parasitic nematode, Skrjabingylus chitwoodorum, in skunks

reveal undescribed variation and/or barriers to gene flow. COI rather than nuclear DNA (such as ribosomal genes) was selected to study the population genetics of the nematode because this gene has been used successfully in several studies (i.e. Lazarova et al., 2006; Prosser et al., 2013). Derycke et al. (2010) used the COI barcoding technique in 41 free-living marine nematode species to discriminate one morphological species from another. They were unable to differentiate only two out of 41 species

Allie N. Denham, Malorri R. Hughes, Robert C. Dowler, Nicholas J. Negovetich, Loren K. Ammerman

Journal of Nematology, Volume 53 , 1–8

research-article | 06-November-2020

Morphological and molecular analyses of a Meloidogyne mali population with high intragenomic rRNA polymorphism

those in the basal clades. In the present study, we reported that a M. mali population was imported from Japan in Ningbo Port, China, with high intragenomic rRNA polymorphisms. We describe this population by detailed morphology and molecular phylogeny, and compare it with other populations in GenBank by mitochondrial COI haplotype network analysis. Materials and methods Isolation and morphological observation of nematodes Roots and a little soil and rhizosphere medium associated with maple (Acer

Jianfeng Gu, Yiwu Fang, Lele Liu

Journal of Nematology, Volume 52 , 1–11

research-article | 30-November-2019

First report of Paratylenchus lepidus Raski, 1975 associated with green tea (Camellia sinensis (L.) Kuntze) in Vietnam

, measurements and pictures were taken using Carl Zeiss Axio Lab. A1 light microscope equipped with a Zeiss Axiocam ERc5s digital camera. For molecular characterization, the D2-D3 region of 28S rDNA and COI mtDNA gene were amplified using D2A/D3B (5′–ACAAGTACCGTGGGGAAAGTTG–3′/5′–TCGGAAGGAACCAGCTACTA–3′) (Subbotin et al., 2006) and JB3/JB4 (5′-TTTTTTGGGCATCCTGAGGTTTAT-3′/5′-TAAAGAAAGAACATAATGAAAATG-3′) (Nguyen et al., 2019b) primers. Forward and reverse sequences were assembled using Geneious R11

Thi Mai Linh Le, Huu Tien Nguyen, Thi Duyen Nguyen, Quang Phap Trinh

Journal of Nematology, Volume 52 , 1–4

Research Article | 17-October-2018

Characterization of Meloidogyne indica (Nematoda: Meloidogynidae) Parasitizing Neem in India, with a Molecular Phylogeny of the Species

juveniles, males and females were carried out by light compound and scanning electron microscopy. Gross morphology and measurements were found consistent with the original description of M. indica infecting citrus by Whitehead (1968). The neem population was found to infect and reproduce on citrus. Additionally, evolutionary relationship was deduced by Maximum likelihood method using ITS rRNA, D2D3 expansion segment of 28S rRNA and mitochondrial COI sequences. Phylogenetic analyses based on these

Victor Phani, Satyapal Bishnoi, Amita Sharma, Keith G. Davies, Uma Rao

Journal of Nematology, Volume 50 , ISSUE 3, 387–398

research-article | 06-November-2020

Morphological and molecular characterizations of Heterodera oryzae in Korea

for 1 min and finished with one cycle at 72°C for 6 min. COI gene of the mtDNA A primer set of JB3 (5′-TTTTTTGGGCATCCTGAGGTTTAT-3′) and JB5 (5′-AGCACCTAAACTTAAAACATAATGAAAATG-3′) (Derycke et al., 2005) was used in the PCR reaction. PCR conditions were pre-denaturation step at 94°C for 4 min followed by 40 cycles of 94°C for 30 sec, 57°C for 30 sec, and 72°C for 45 sec and finished with one cycle at 72°C for 5 min. PCR products were analyzed by electrophoresis on 1% agarose gel with 1X TAE

Rose Mwesige, Eun-Hwa Kim, Eun-Hyung Park, Hyoung-Rai Ko

Journal of Nematology, Volume 52 , 1–12

Research Article | 03-September-2018

First Report of Carrot Cyst Nematode Heterodera carotae in Mexico: Morphological, Molecular Characterization, and Host Range Study

was made using light and scanning electron microscopy of the second stage juveniles, females, males and cysts, and the host range study, was performed with nine different plants from five families. The molecular identification was made by sequencing and analysing the ITS rRNA and partial COI genes. It was shown that using presently available molecular tools it is not possible to make an accurate differentiation of H. carotae from H. cruciferae. The host range test allowed to distinguish these

Ilia Mariana Escobar-Avila, Edgar Óliver López-Villegas, Sergei A. Subbotin, Alejandro Tovar-Soto

Journal of Nematology, Volume 50 , ISSUE 2, 229–242

research-article | 30-November-2019

Characterization of a population of Pelodera strongyloides (Nematoda: Rhabditidae) associated with the beetle Lucanus ibericus (Coleoptera: Lucanidae) from Georgia

. In the present study, a Georgian population of P. strongyloides recovered for the first time from L. ibericus and was fully characterized by morphology and morphometrics. Furthermore, the PCR amplification and sequencing of the D2 to D3 expansion domains of the 28S rRNA gene, the ITS, and the mitochondrial COI were carried out. The phylogenetic relationships of P. strongyloides from Georgia to other Pelodera species and Rhabditidae were also reconstructed. Materials and methods Nematode

O. Gorgadze, A. Troccoli, E. Fanelli, E. Tarasco, F. De Luca

Journal of Nematology, Volume 52 , 1–12

research-article | 30-November-2019

Morphological and molecular characterization of Heterodera dunensis n. sp. (Nematoda: Heteroderidae) from Gran Canaria, Canary Islands

field differentiation, tail length, and hyaline tail length in J2 (Subbotin et al., 2010). Since the last two decades, employing molecular data such as ITS and 28S of ribosomal DNA and COI gene of mitochondrial DNA to characterize Heterodera species has been a common practice, including DNA barcoding, phylogeny, and even phylogeography (Ferris et al., 1999; Toumi et al., 2013a; Subbotin et al., 2017, 2018). Herein, we characterize Heterodera dunensis n. sp. discovered in a recent exploratory survey

Phougeishangbam Rolish Singh, Gerrit Karssen, Marjolein Couvreur, Wim Bert

Journal of Nematology, Volume 52 , 1–14

research-article | 11-January-2021

On the molecular identity of Paratylenchus nanus Cobb, 1923 (Nematoda: Tylenchida)

GTT GGA ACT TCT TGA AC – 3’) and COIR9 (5’–CTT AAA ACA TAA TGR AAA TGW GCW ACW ACA TAA TAA GTA TC – 3’) amplifying the partial COI gene (Powers et al., 2014) were used in this study. PCR products were purified using the QIAquick Gel Extraction Kit (Qiagen) according to the manufacturer’s instructions and submitted to direct sequencing at GENEWIZ (CA, USA). The new Paratylenchus sequences were submitted to the GenBank database under accession numbers: MT668705, MT668708-MT668712, MW234449, MW234450

Sergei A. Subbotin, Guiping Yan, Mihail Kantor, Zafar Handoo

Journal of Nematology, Volume 52 , 1–7

Article | 21-July-2017

First Report and Comparative Study of Steinernema surkhetense (Rhabditida: Steinernematidae) and its Symbiont Bacteria from Subcontinental India

isolates possess six ridges in their lateral field instead of eight reported in the original description. The analysis of ITS-rDNA sequences revealed nucleotide differences at 345, 608, and 920 positions in aligned data. No difference was observed in D2-D3 domain. The S. surkhetense COI gene was studied for the first time as well as the molecular characterization of their Xenorhabdus symbiont using the sequences of recA and gyrB genes revealing Xenorhabdus stockiae as its symbiont

AASHIQ HUSSAIN BHAT, I STKHAR, ASHOK KUMAR CHAUBEY, VLADIMIR PUZA, ERNESTO SAN-BLAS

Journal of Nematology, Volume 49 , ISSUE 1, 92–102

research-article | 30-November-2019

Plant-parasitic nematodes associated with sugarcane in Kilimanjaro, Tanzania

data by taking pictures and measurements using the above camera-equipped microscope. This was followed by DNA extraction from individual nematodes as described in the study of Singh et al. (2018) and the resulting genomic DNA sample was used for the amplification of the partial ITS and D2-D3 region of the 28S of rRNA gene and the COI gene of mtDNA. PCR amplification of the partial ITS was done using the primer pair Vrain2F: 5´-CTTTGTACACACCGCCCGTCGCT-3´/Vrain2R: 5´-TTTCACTCGCCGTTACTAAGGGAATC-3

Phougeishangbam Rolish Singh, Beatrice E. Kashando, Marjolein Couvreur, Gerrit Karssen, Wim Bert

Journal of Nematology, Volume 52 , 1–17

research-article | 22-February-2021

Rotylenchus wimbii n. sp. (Nematoda: Hoplolaimidae) associated with finger millet in Kenya

accepted and its widespread use has also recently been facilitated by a web-based key that draws its basis from cluster analysis (Nguyen et al., 2019). In combination with the morphological features, molecular information such as ITS, 18S, and 28S of ribosomal DNA and COI of mitochondrial DNA have been used for their identification. In the current paper, we characterize a newly discovered Rotylenchus wimbii n. sp. found associated with finger millet, Eleusine coracana (L.) Gaertn. (Planta: Poaceae) in

Phougeishangbam Rolish Singh, Gerrit Karssen, Kelvin Gitau, Cecilia Wanjau, Marjolein Couvreur, Njira Njira Pili, Godelieve Gheysen, Wim Bert

Journal of Nematology, Volume 53 , 1–14

research-article | 30-November-2019

Description of Deladenus brevis n. sp. (Sphaerularioidea: Neotylenchidae) from Iran: a morphological and molecular phylogenetic study

species of Deladenus was recovered from a deadwood sample of a dead forest tree collected from the forests of Golestan province, northern Iran. Thus, the present paper aims to describe the newly recovered species and resolve its phylogenetic relationships with other relevant species and genera using three SSU, LSU rDNA, and COI mtDNA markers. Materials and methods Sampling, nematode extraction, mounting, and drawing Specimens of Deladenus brevis n. sp. were obtained from the bark and rotten wood

Fariba Heydari, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 52 , 1–13

research-article | 24-April-2019

Description of Rotylenchus rhomboides n. sp. and a Belgian population of Rotylenchus buxophilus (Tylenchomorpha: Hoplolaimidae)

morphology and morphometrics along with molecular characteristics and phylogeny of the D2-D3 expansion segment of 28S rDNA, ITS rDNA, and COI mtDNA sequences. Materials and methods Sampling and nematode extraction The soil and root samples were collected around the rhizosphere of banana (Musa basjoo Siebold & Zucc. ex Iinuma) (GPS coordinates N: 51°2′6.8″, E: 3°43′22.7″) and Yam (Dioscorea tokoro) (GPS coordinates: N: 51°2′6.9″, E: 3°43′22.6″) at the Botanical garden of Ghent University. The nematodes

Huu Tien Nguyen, Quang Phap Trinh, Marjolein Couvreur, Phougeishangbam Rolish Singh, Wilfrida Decraemer, Wim Bert

Journal of Nematology, Volume 51 , 1–20

research-article | 30-November-2019

Morphological and molecular characterization of Pratylenchus species from Yam (Dioscorea spp.) in West Africa

number of diagnostic features and high intraspecific variability (Luc, 1987; Duncan et al., 1999; Castillo and Vovlas, 2007). To establish the diversity of Pratylenchus spp., associated with yam, surveys were conducted in the main yam producing areas in Nigeria and Ghana. The Pratylenchus populations obtained from yam tuber tissue and yam rhizosphere were morphologically characterized and molecularly confirmed by sequencing of the D2-D3 of 28 S rDNA and mitochondrial COI genes. Materials and methods

Yao A. Kolombia, Oluwadamilola Ogundero, Emmanuel Olajide, Nicole Viaene, P. Lava Kumar, Danny L. Coyne, Wim Bert

Journal of Nematology, Volume 52 , 1–25

research-article | 30-November-2019

Intraspecific variation in phenotypic and phylogenetic features among Pratylenchus penetrans isolates from Wisconsin, USA

identification today should be supported by molecular analyses so sequence data are rapidly accumulating for multiple gene fragments including the cytochrome c oxidase subunit1 (COI) mitochondrial gene (Janssen et al., 2017), rDNA internal transcribed spacers (De Luca et al., 2011), D2/D3 expansion region of 28S rDNA, and 18S rDNA (Subbotin et al., 2008). Janssen et al. (2017) used a combination of morphological and sequence data of COI to successfully distinguish species among the Penetrans group of

Kanan Saikai, Ann E. MacGuidwin

Journal of Nematology, Volume 52 , 1–17

research-article | 30-November-2019

First report of the bent seed gall nematode, Anguina agrostis (Steinbuch, 1799) Filipjev, 1936 from Poa palustris L. in Wyoming, USA

the forward AngF1-agro (5′-CGT TTA AAC TCT ATT AGT CTG TGG-3′) primer and a mixture of the reverse AnguinaR1a (5′-CCA AAA AAC CAA AAT AGA TGC TG-3′) and AnguinaR1b (5′-CCG AAG AAC CAG AAG AGG TGC TG-3′) primers. The PCR products were purified and directly sequenced in GENEWIZ (CA, USA). New sequences were deposited in the GenBank database under accession numbers: MW165338 (ITS1-5.8S-ITS2 rRNA gene) and MW174765 (COI gene). Blastn search showed that the ITS rRNA and COI gene sequences of nematode

Tatiana V. Roubtsova, Sergei A. Subbotin

Journal of Nematology, Volume 52 , 1–3

research-article | 30-November-2018

The morphological characteristics and phylogenetic analysis of Pratylenchus vulnus Taiwan strawberry isolate

Blaxter, 2003) and mtDNA COI region (JB3/JB4.5: TTTTTTGGGCATCCTGAGGTTTAT/TAAAGAAAGAACATAATGAAAATG) (Derycke et al., 2010) of the Pv-GS and Pv-KDL are 99.04, 95.96, 99.66 and 99.24% identical, respectively. Both Pv-GS and Pv-KDL isolates had maximum 100% similarity of their rDNA LSU sequences to P. vulnus (GenBank accession: U47547.1). The Pv-KDL mtDNA COI region sequences of isolates were 99.74 to 100% similar to other sequences of P. vulnus available in the database (GenBank accessions KY424094

Yu-po Lin, Wan-chun Lee, Pei-che Chung, Jiue-in Yang

Journal of Nematology, Volume 51 , 1–5

research-article | 30-November-2018

Morpho-molecular characterization of Colombian and Brazilian populations of Rotylenchulus associated with Musa spp

processing. The D2-D3 expansion region of the large subunit (LSU) of ribosomal DNA (28 S) was amplified using primers D2A (forward, 5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and D3B (reverse, 5′-TCCTCGGAAGGAACCAGCTACTA-3′) (De Ley et al., 1999). Also, a partial region of the mitochondrial cytochrome oxidase subunit I (COI) was amplified using primers JB3 (forward, 5′-TTTTTTGGGCATCCTGAGGTTTAT-3′) and JB4.5 (reverse, 5′-TAAAGAAAGAACATAATGAAAATG-3′) (Bowles et al., 1992). The PCR conditions were initial denaturation

Donald Riascos-Ortiz, Ana Teresa Mosquera-Espinosa, Francia Varón De Agudelo, Claudio Marcelo Gonçalves de Oliveira, Jaime Eduardo Muñoz-Flórez

Journal of Nematology, Volume 51 , 1–13

research-article | 16-April-2020

De novo transcriptome sequencing and analysis of Anisakis pegreffii (Nematoda: Anisakidae) third-stage and fourth stage larvae

collagen genes (col-34, col-138, col-40) were highly expressed in APL4. Several mitochondrial enzyme genes (COI, COII, COIII) were highly expressed both in APL3 and APL4 (Tables 4 and 5). Table 4. Top 20 most abundant unigenes in A. pegreffii L3. No. ID Name Description 1 TBIU006603 COIII Cytochrome c oxidase subunit 3 2 TBIU013810 COI Cytochrome c oxidase subunit 1 3 TBIU015558 UBB Polyubiquitin-B 4 TBIU017350 ZK970.7 Protein ZK970.7 5 TBIU017923 act-2b Actin-2 6 TBIU015560

U-Hwa Nam, Jong-Oh Kim, Jeong-Ho Kim

Journal of Nematology, Volume 52 , 1–16

research-article | 30-November-2020

Multi-locus phylogenetic analyses uncover species boundaries and reveal the occurrence of two new entomopathogenic nematode species, Heterorhabditis ruandica n. sp. and Heterorhabditis zacatecana n. sp.

, 2002; Haag et al., 2018). In addition, the use of sequences containing several ambiguous nucleotides, potentially arisen from sequencing errors and/or poor quality-control, leads to erroneous taxonomic affiliations, as it is exemplified by the relatively high number of synonym species in the genus Heterorhabditis (Dhakal et al., 2020; Hunt and Nguyen, 2016). The use of mitochondrial DNA such as COI sequences, the gold standard taxonomic marker for species delimitation in the Kingdom Animalia, may

Ricardo A.R. Machado, Aashaq Hussain Bhat, Joaquín Abolafia, Arthur Muller, Pamela Bruno, Patrick Fallet, Carla C.M. Arce, Ted C.J. Turlings, Julio S. Bernal, Joelle Kajuga, Bancy Waweru, Stefan Toepfer

Journal of Nematology, Volume 53 , 1–42

research-article | 15-August-2017

Description and Distribution of Three Criconematid Nematodes from Hangzhou, Zhejiang Province, China

the identity of these three species by morphological and molecular characterization, (2) integrate the morphometric characterization of Chinese populations of D. limitanea and C. parvus with measurements reported from different countries, (3) evaluate the phylogenetic and biogeographic relationships of these species within Criconematidae using 18S and COI DNA sequence. Materials and methods Nematode detection and morphological observations: Soil samples were collected from undisturbed natural

Maria Munawar, Thomas O. Powers, Zhongling Tian, Timothy Harris, Rebecca Higgins, Jingwu Zheng

Journal of Nematology, Volume 50 , ISSUE 2, 183–206

research-article | 24-November-2020

Description of Heterodera microulae sp. n. (Nematoda: Heteroderinae) from China – a new cyst nematode in the Goettingiana group

diagnosis is gaining more reliability for precise and accurate identification of cyst-forming nematodes (Peng et al., 2003). The internal transcribed spacer region of the ribosomal DNA (ITS-rDNA), the D2 and D3 expansion fragments of the 28S ribosomal DNA genes (D2-D3 of 28S-rDNA), and mitochondrial DNA (COI gene) units are good candidate genes for molecular taxonomic and phylogenetic studies (Subbotin et al., 2001; Subbotin et al., 2006; Madani et al., 2004; Vovlas et al., 2017). Based on

Wenhao Li, Huixia Li, Chunhui Ni, Deliang Peng, Yonggang Liu, Ning Luo, Xuefen Xu

Journal of Nematology, Volume 52 , 1–16

research-article | 30-November-2020

First report of Seville root-knot nematode, Meloidogyne hispanica (Nematoda: Meloidogynidae) in the USA and North America

Ley et al. (2005). The mitochondrial nad5 region was amplified with primers NAD5F2 [5′-TATTTTTTGTTTGAGATATATTAG-3′] and NAD5R1 [5′-TATTTTTTGTTTGAGATATATTAG-3′] as described (Janssen et al., 2016); the mtDNA intergenic COII-16S region was amplified with primers C2F3 [5′-GGTCAATGTTCAGAAATTTGTGG-3′] and 1108 [5′-TACCTTTGACCAATCACGCT-3′] as described by Powers and Harris (1993); and mitochondrial COI was amplified with primers JB3 [5′-TTTTTTGGGCATCCTGAGGTTTAT-3′] and JB5 [5

Andrea M. Skantar, Zafar A. Handoo, Sergei A. Subbotin, Mihail R. Kantor, Paulo Vieira, Paula Agudelo, Maria N. Hult, Stephen Rogers

Journal of Nematology, Volume 53 , 1–7

Research Article | 03-December-2018

First report of Bursaphelenchus antoniae from Pinus strobus in the U.S.

only 95% similarity with PWN B. xylophilus. Compared to the previously described Portuguese population of B. antoniae, the sequences generated for the MA population were 98.3% similar in the ITS1, 2 rDNA and 99.9% similar for 28S rDNA. There was 99.2% similarity between the COI sequences of the US and Portuguese isolates of B. antoniae. This population has morphology consistent with that of Penas et al., 2006; however, the female tail on this MA pine population is mucronate and more attenuated than

Lynn K. Carta, R. L. Wick

Journal of Nematology, Volume 50 , ISSUE 4, 473–478

research-article | 30-November-2020

Report of the Texas peanut root-knot nematode, Meloidogyne haplanaria (Tylenchida: Meloidogynidae) from American pitcher plants (Sarracenia sp.) in California

mitochondrial COI gene (Humphreys-Pereira et al., 2021; Subbotin, 2021a). The new sequences for each gene were aligned using ClustalX 1.83 with their corresponding published gene sequences of M. haplanaria and other root-knot nematode species (Alvarez-Ortega et al., 2019; Georgi and Abbott, 1998; Joseph et al., 2016; Khanal et al., 2016; Powers et al., 2005; Ye et al., 2019 and others). Sequence datasets were analyzed with Bayesian inference (BI) using MrBayes 3.1.2 as described by Subbotin (2021b). The new

Sergei A. Subbotin

Journal of Nematology, Volume 53 , 1–7

Research Article | 26-September-2018

Occurrence of Sheraphelenchus sucus (Nematoda: Aphelenchoidinae) and Panagrellus sp. (Rhabditida: Panagrolaimidae) Associated with Decaying Pomegranate Fruit in Italy

rRNA gene, D2–D3 expansion domains of the 28S rDNA, the ITS region, and the partial mitochondrial COI were carried out. Sequences of the 18S rRNA gene, the D2–D3 domains, and the ITS were analyzed using several methods for inferring phylogeny to reconstruct the relationships among Sheraphelenchus and Bursaphelenchus species. The bacterial feeder Panagrellus sp. was characterized at the molecular level only. The D2–D3 expansion domains and ITS sequences of this Italian panagrolaimid were determined

ELENA FANELLI, ALBERTO TROCCOLI, NICOLA VOVLAS, GIANLUCA SCARCIA, ANNAMARIA MINCUZZI, SIMONA M. SANZANI, ANTONIO IPPOLITO, FRANCESCA DE LUCA

Journal of Nematology, Volume 49 , ISSUE 4, 418–426

research-article | 11-March-2021

Morphological and molecular characters of Scutellonema brachyurus (Steiner, 1938) Andrássy, 1958 from South Africa

finally spin for 2 min at 16,000 rpm (Shokoohi et al., 2018). The supernatant was then extracted from each of the tubes and stored at –20°C. Following this step, the forward and reverse primers, D2A (5’–ACAAGTACCGTGAGGGAAAGTTG–3’), D3B (5’–TCGGAAGGAACCAGCTACTA–3’) (De Ley et al., 1999), and JB3 (5’–TTTTTTGGGCATCCTGAGGTTTAT–3’), JB4.5 (5’–TAAAGA AAGAACATAATGAAAATG–3’) (Derycke et al., 2010), were used in the PCR reactions for partial amplification of the 28 S rDNA and COI of mtDNA regions, respectively

Ebrahim Shokoohi

journal of nematology, Volume 53 , 1–13

research-article | 30-November-2018

A loop-mediated isothermal amplification assay for the plant-parasitic nematode Aphelenchoides besseyi in rice seedlings

. Multiple sequences alignments were performed using Geneious 9.1.6 software (Biomatters Inc., CA, USA) and the mitochondria COI gene was finally selected as primer target due to its relatively high sequence variation among the Aphelenchoides species. The LAMP primers were designed using PrimerExplorer v.5 software (Eiken chemical Co., Ltd, Tokyo, Japan). Four sets of primers, AB-ID14, AB-ID30, AB-ID37 and AB-ID40, were used for further testing. Among them, the AB-ID37 set contains four primers that

Jiue-in Yang, Guan-yi Yu

Journal of Nematology, Volume 51 , 1–11

research-article | 30-March-2020

Characterization of Vittatidera zeaphila (Nematoda: Heteroderidae) from Indiana with molecular phylogenetic analysis of the genus

 μl 50 mM MgCl2, and 2.5 µl PCR buffer in a total volume of 25 µl. PCR cycling conditions were 95°C for 3 min, 35X (94°C for 30 sec, 50°C for 40 sec, 72°C for 70 sec), 72°C for 5 min, 4°C until finish. COI: Mitochondrial cytochrome oxidase I (COI) was amplified with primers Het-coxiF [5′-TAGTTGATCGTAATTTTAATGG-3′] and Het-coxiR [5′-CCTAAAACATAATGAAAATGWGC-3′]. Amplifications were performed in 25 µl reactions with 1x PicoMaxx (Agilent) buffer, 0.2 mM dNTPs, 0.3 µM each primer, 0.125 µl Dream Taq

Andrea M. Skantar, Zafar A. Handoo, Mihail R. Kantor, Lynn K. Carta, Jamal Faghihi, Virginia Ferris

Journal of Nematology, Volume 52 , 1–8

research-article | 30-November-2019

Molecular and morphological characterization of the amaryllis lesion nematode, Pratylenchus hippeastri (Inserra et al., 2007), from California

oxidase I (COI) was amplified with JB3 [5’-TTTTTTGGGCATCCTGAGGTTTAT-3’] and JB5 [5’-AGCACCTAAACTTAA AACATAATGAAAATG-3’] (Derycke et al., 2005) as described in Ozbayrak et al. (2019). PCR amplicons of 403 bp were cleaned and sequenced directly with the same primers. The 28 S large ribosomal subunit D2-D3 expansion segment was obtained via amplification with the primers D2A [5’-ACAAGTACCGTGAGGGAAAGTTG-3’] and D3B [5’-TCGGAAGGAACCAGCTACTA-3’] (De Ley et al., 2005; Ye et al., 2007), producing sequences of

Zafar A. Handoo, Andrea M. Skantar, Mihail R. Kantor, Saad L. Hafez, Maria N. Hult

Journal of Nematology, Volume 52 , 1–5

research-article | 30-November-2020

Molecular and morphological characterization of a first report of Cactodera torreyanae Cid del Prado Vera & Subbotin, 2014 (Nematoda: Heteroderidae) from Minnesota, the United States of America

amplification of the ITS1-5.8S-ITS2 of rRNA gene, the forward JB3 (5′ – TTT TTT GGG CAT CCT GAG GTT TAT -3′) and the reverse JB4.5 (5′ – TAA AGA AAG AAC ATA ATG AAA ATG -3′) primers or the forward Het-coxiF (5′ – TAG TTG ATC GTA ATT TTA ATG G – 3′) and the reverse Het-coxiR (5′ – CCT AAA ACA TAA TGA AAA TGW GC – 3′) primers for amplification of the partial COI gene (Skantar et al., 2021; Subbotin, 2021a). DNA sequencing was conducted by University of Maryland Center for Biosystems Research and Genewiz, Inc

Zafar A. Handoo, Andrea M. Skantar, Sergei A. Subbotin, Mihail R. Kantor, Maria N. Hult, Michelle Grabowski

Journal of Nematology, Volume 53 , 1–5

research-article | 30-November-2018

New data on known species of Hirschmanniella and Pratylenchus (Rhabditida, Pratylenchidae) from Iran and South Africa

used in the PCR reactions for partial amplification of the 18S rDNA, ITS rDNA, 28S rDNA, and COI of mtDNA region. PCR was conducted with 8 µl of the DNA template, 12.5 µl of 2X PCR Master Mix Red (Promega, USA) for the South African specimens and (Pishgam, Iran) for the Iranian specimens), 1 µl of each primer (10 pmol µl−1), and ddH2O for a final volume of 30 µl. The amplification was processed using an Eppendorf master cycler gradient (Eppendorf, Hamburg, Germany), with the following program

Ebrahim Shokoohi, Joaquín Abolafia, Phatu William Mashela, Nafiseh Divsalar

Journal of Nematology, Volume 51 , 1–26

research-article | 30-November-2020

Evaluation of indigenous entomopathogenic nematodes in Southwest China as potential biocontrol agents against Spodoptera litura (Lepidoptera: Noctuidae)

of rDNA containing internal transcribed spacer (ITS1, 5.8S, ITS2) was amplified using primers 18S: 5′-TTG ATT ACG TCC CTG CCC TTT-3′ (forward), and 28S: 5′-TTT CAC TCG CCG TTA CTA AGG-3′ (reverse) (Vrain et al., 1992). The other fragment containing D2-D3 regions of 28S rDNA was amplified using primers D2F: 5′-CCTTAGTAACGGCGAGTGAAA-3′ (forward) and 536: 5′-CAGCTATCCTGAGGAAAC-3′ (reverse) (Nguyen and Hunt, 2007). COI-F1 (5′-CCTACTATGATTGGTGGTTTTGGTAATTG-3′) and COI-R2 (5′-GTAGCAGCAGTAAAATAAGCACG-3

Bingjiao Sun, Xiuqing Zhang, Li Song, Lixin Zheng, Xianqin Wei, Xinghui Gu, Yonghe Cui, Bin Hu, Toyoshi Yoshiga, Mahfouz M. Abd-Elgawad, Weibin Ruan

Journal of Nematology, Volume 53 , 1–17

Research Article | 17-October-2018

First Report of the Yellow Nutsedge Cyst Nematode, Heterodera cyperi, in Georgia, U.S.A.

extracted from single cysts (n = 3) and internal transcribed spacer (ITS) of rRNA and partial cytochrome oxidase I (COI) genes were amplified with primers TW81/AB28 and Het-coxiF/Het-coxiR, respectively (Subbotin et al., 2001; Subbotin, 2015) and sequenced. The resulting sequences were deposited into the GenBank database (Accession no. MG825344 and MG857126) and also subjected to BLAST searches in the database. ITS sequence of H. cyperi showed 100% similarity (100% coverage) with that of a H. cyperi

Abolfazl Hajihassani, Bhabesh Dutta, Ganpati B. Jagdale, Sergei A. Subbotin

Journal of Nematology, Volume 50 , ISSUE 3, 456–458

research-article | 26-April-2019

First report of Meloidogyne javanica on Ginger and Turmeric in the United States

Abolfazl Hajihassani, Weimin Ye, Brooke B. Hampton

Journal of Nematology, Volume 51 , 1–3

No Record Found..
Page Actions