Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Letter to the Editor
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • critical-appraisal
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • non-scientific
  • Obituary
  • original-paper
  • original-report
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • review-paper
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • short-communication
  • short-report
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • Polish Journal Of Microbiology
  • Journal Of Nematology

 

Article | 21-July-2017

First Report and Comparative Study of Steinernema surkhetense (Rhabditida: Steinernematidae) and its Symbiont Bacteria from Subcontinental India

isolates possess six ridges in their lateral field instead of eight reported in the original description. The analysis of ITS-rDNA sequences revealed nucleotide differences at 345, 608, and 920 positions in aligned data. No difference was observed in D2-D3 domain. The S. surkhetense COI gene was studied for the first time as well as the molecular characterization of their Xenorhabdus symbiont using the sequences of recA and gyrB genes revealing Xenorhabdus stockiae as its symbiont

AASHIQ HUSSAIN BHAT, I STKHAR, ASHOK KUMAR CHAUBEY, VLADIMIR PUZA, ERNESTO SAN-BLAS

Journal of Nematology, Volume 49 , ISSUE 1, 92–102

research-article | 28-April-2020

Morphological and molecular characterization of Acrobeloides saeedi Siddiqi, De Ley and Khan, 1992 (Rhabditida, Cephalobidae) from India and comments on its status

´ (reverse) (Nadler et al., 2006). The PCR master mix consisted of ddH2O 16.8 μl, 10× PCR buffer 2.5 μl, dNTP mix (10 mM each) 0.5 μl, 1 μl of each forward and reverse primers, dream taq green DNA polymerase 0.2 μl and 3 μl of DNA extract. The PCR profiles used was: 1 cycle of 94°C for 3 min followed by 40 cycles of 94°C for 30 sec, + 54°C for 30 sec for 18 S rDNA, 52°C for 30 sec for 28 S rDNA or 55°C for 30 sec for ITS rDNA, + 72°C for 60 sec, and a final extension at 72°C for 10 min. PCR was followed

Aasha Rana, Aashaq Hussain Bhat, Suman Bhargava, Ashok Kumar Chaubey, Joaquín Abolafia

Journal of Nematology, Volume 52 , 1–21

research-article | 16-January-2021

Occurrence and molecular characterization of Meloidogyne graminicola on rice in Central Punjab, Pakistan

073.07427 JB2 UAF KX757065.1 328 bp 58 J.B 186 31.46937 072.99122 JB3FSD1 KX757066.1 326 bp 218 J.B 173 V 31.43074 072.97399 JB3FSD2 KX757067.1 326 bp 442 G.B 172 V 31.04441 073.00982 JB3FSD3 MH057345.1 326 bp 424 G.B 172 V 31.08084 073.14034 JB3FSD4 MH057346.1 326 bp 205 R.B 186 V 31.43253 073.23050 JB3FSD5 MH057347.1 326 bp 70 J.B 181 V 31.36304 72.909520 JB3FSD6 MH057348.1 326 bp Figure 4: ITS rDNA PCR amplification products using forward primer rDNA2 and reverse primer rDNA1.58 s

Abdul Jabbar, Nazir Javed, Anjum Munir, Huma Abbas, Sajid A. Khan, Anam Moosa, Muhammad Jabran, Byron J. Adams, Muhammad A. Ali

Journal of Nematology, Volume 52 , 1–17

Short Communication | 28-June-2017

Morphological and Molecular Characterization of Phoma complanata, a New Causal Agent of Archangelica officinalis Hoffm. in Poland

Beata Zimowska, Ewa Dorota Zalewska, Ewa Dorota Król, Agnieszka Furmańczyk

Polish Journal of Microbiology, Volume 66 , ISSUE 2, 281–285

research-article | 14-December-2020

Morphological, morphometrical, and molecular characterization of Metarhabditis amsactae (Ali, Pervez, Andrabi, Sharma and Verma, 2011) Sudhaus, 2011 (Rhabditida, Rhabditidae) from India and proposal of Metarhabditis longicaudata as a junior synonym of M. amsactae

Jacob, 2012, and Oscheius amsactae Ali, Pervez, Andrabi, Sharma and Verma, 2011 and Metarhabditis longicaudata Tabassum, Salma and Nasir, 2019. Most of these studies, however, have characterized the species morphologically and morphometrically. Regarding molecular analysis, several Internal Transcribed Spacer (ITS) rDNA sequences, obtained from M. amsactae isolated in India, Philippines, and Pakistan have been deposited in the GenBank, but none of the nematode specimens used to obtain the sequences

Aashaq Hussain Bhat, Shreyansh Srivastava, Aasha Rana, Ashok Kumar Chaubey, Ricardo A. R. Machado, Joaquín Abolafia

Journal of Nematology, Volume 52 , 1–23

Research Article | 03-September-2018

Molecular Characterization and Phylogeny of Ditylenchus weischeri from Cirsium arvense in the Prairie Provinces of Canada

molecular analysis of many D. weischeri specimens from Canada is presented. Individuals from 41C. arvense or yellow pea grain samples with seeds of C. arvense from the Prairie Provinces were sequenced for the internal transcribed spacer (ITS rDNA), large subunit (LSU) D2D3 28S rDNA, partial segment of small subunit (SSU) 18S rDNA, and the heat shock protein Hsp90 gene. The analysis also included D. weischeri individuals from C. arvense from Russia and garlic with D. dipsaci from the Provinces of Ontario

Mehrdad Madani, Mario Tenuta

Journal of Nematology, Volume 50 , ISSUE 2, 163–182

research-article | 30-November-2020

Steinernema sandneri n. sp. (Rhabditida: Steinernematidae), a new entomopathogenic nematode from Poland

positions in the sequences of S. sandneri S17-050 was computed using the same program. Accessions numbers of all sequences and details on nematode taxa used in the molecular study are presented in Table S1. Table S1. Details on taxa used in the molecular analyses. GeneBank accession no. Species Isolate name/geographic origin ITS rDNA 28S rDNA cox1 Steinernema sandneri n. sp. S17-050, Poland MW078536 MW078535 MW078544 Steinernema affine B1, England AF331899

Magdalena Lis, Ewa Sajnaga, Marcin Skowronek, Adrian Wiater, Kamila Rachwał, Waldemar Kazimierczak

Journal of Nematology, Volume 53 , 1–24

research-article | 30-November-2019

Further observations on Meloidogyne enterolobii (Nematoda: Meloidogynidae) infecting guava (Psidium guajava) in India

et al., 2004; Paes et al., 2012) (Fig. 4A). Taxonomic identification of M. enterolobii has proved to be very challenging based on only the traditional means and has resulted in incorrect identification and misreporting (Brito et al., 2004). Molecular characterization based on ITS rDNA sequences (NCBI GenBank accession number KT271569) and SCAR marker resulted in authentication of the species (Fig. 4B). In this line, use of molecular markers, viz., ribosomal D2D3 expansion segment, ITS rDNA, IGS

Tushar Manohar Ghule, Victor Phani, Vishal Singh Somvanshi, Maya Patil, Somnath Bhattacharyya, Matiyar Rahaman Khan

Journal of Nematology, Volume 52 , 1–9

research-article | 24-November-2020

Description of Heterodera microulae sp. n. (Nematoda: Heteroderinae) from China – a new cyst nematode in the Goettingiana group

diagnosis is gaining more reliability for precise and accurate identification of cyst-forming nematodes (Peng et al., 2003). The internal transcribed spacer region of the ribosomal DNA (ITS-rDNA), the D2 and D3 expansion fragments of the 28S ribosomal DNA genes (D2-D3 of 28S-rDNA), and mitochondrial DNA (COI gene) units are good candidate genes for molecular taxonomic and phylogenetic studies (Subbotin et al., 2001; Subbotin et al., 2006; Madani et al., 2004; Vovlas et al., 2017). Based on

Wenhao Li, Huixia Li, Chunhui Ni, Deliang Peng, Yonggang Liu, Ning Luo, Xuefen Xu

Journal of Nematology, Volume 52 , 1–16

research-article | 30-November-2020

A new cyst-forming nematode, Cactodera tianzhuensis n. sp. (Nematoda:Heteroderinae) from Polygonum viviparum in China with a key to the Genus Cactodera

length of stylet, tail and hyaline tail in second-stage juvenile, and the surface differentiation in eggs (Subbotin et al., 2010). However, traditional identification of cyst forming nematode based on morphology is imprecise and time-consuming to separate the related species. During the past 30 years, molecular data, including ITS-rDNA, D2-D3 region of 28S-rDNA, are more accurate tool for identification of cyst-forming nematode species. Sequence analysis of the ITS-rDNA and the D2-D3 region of 28S

Wenhao Li, Huixia Li, Chunhui Ni, Mingming Shi, Xuejuan Wei, Yonggang Liu, Yiwen Zhang, Deliang Peng

Journal of Nematology, Volume 53 , 1–15

research-article | 27-May-2019

Description of Geocenamus vietnamensis sp. n. (Nematoda: Merliniidae) from Vietnam

. (1999). Primers for D2–D3 of 28S rDNA amplification were D2A (59-ACAAGTACCGTGGGGAAAGTTG-39) and D3B (59-TCGGAAGGAACCAGCTACTA-39) (Subbotin et al., 2006). Primers for ITS rDNA amplification were modified from Vrain et al. (1992): VRAIN 2F (59-CTTTGTACACACCGCCCGTCGCT-39) and VRAIN 2R (59-TTTCACTCGCCGTTACTAAGGGAATC-39). Phylogenetic analyses The BLAST homology search program was used to search for closely related species on GenBank. The sequence data set was aligned with the ClustalW software

Huu Tien Nguyen, Thi Mai Linh Le, Thi Duyen Nguyen, Gracia Liebanas, Thi Anh Duong Nguyen, Quang Phap Trinh

Journal of Nematology, Volume 51 , 1–12

research-article | 24-April-2019

Description of Rotylenchus rhomboides n. sp. and a Belgian population of Rotylenchus buxophilus (Tylenchomorpha: Hoplolaimidae)

morphology and morphometrics along with molecular characteristics and phylogeny of the D2-D3 expansion segment of 28S rDNA, ITS rDNA, and COI mtDNA sequences. Materials and methods Sampling and nematode extraction The soil and root samples were collected around the rhizosphere of banana (Musa basjoo Siebold & Zucc. ex Iinuma) (GPS coordinates N: 51°2′6.8″, E: 3°43′22.7″) and Yam (Dioscorea tokoro) (GPS coordinates: N: 51°2′6.9″, E: 3°43′22.6″) at the Botanical garden of Ghent University. The nematodes

Huu Tien Nguyen, Quang Phap Trinh, Marjolein Couvreur, Phougeishangbam Rolish Singh, Wilfrida Decraemer, Wim Bert

Journal of Nematology, Volume 51 , 1–20

research-article | 30-November-2019

Hemicycliophora ahvasiensis n. sp. (Nematoda: Hemicycliophoridae), and data on a known species, from Iran

reverse primer D3B (5’–TCGGAAGGAACCAGCTACTA–3’) (Nunn, 1992). Primers for amplification of ITS rDNA were forward primer TW81 (5’–GTTTCCGTAGGTGAACCTGC–3’) and reverse primer AB28 (5’–ATATGCTTAAGTTCAGCGGGT–3’) as described in Vovlas et al. (2008). The 25 μl PCR mixture contained 14.5 μl of distilled water, 3 μl of 10 × PCR buffer, 0.5 μl of 10 mM dNTP mixture, 1.5 μl of 50 mM MgCl2, 1 μl of each primer (10 pmol/μl), 0.5 μl of Taq DNA polymerase (Cinna Gen, Tehran, Iran, 5 U/μl), and 3 μl of DNA template

Sedighe Azimi, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 52 , 1–19

Report | 21-July-2017

First Report of the Spiral Nematode Helicotylenchus microlobus Infecting Soybean in North Dakota

identified as Helicotylenchus microlobus according to morphological and morphometric characteristics (Subbotin et al., 2015). DNA was extracted from single nematodes (n = 8) using the Proteinase K method (Kumari and Subbotin, 2012). The internal transcribed spacer (ITS) region of rDNA was amplified with the primers rDNA2/rDNA1.58S (Cherry et al., 1997). The PCR products were then purified and sequenced. The consensus ITS rDNA sequence (accession no. KY271078, 822 bp) that was

GUIPING YAN, ADDISON PLAISANCE, DANQIONG HUANG, ZAFAR A. HANDOO

Journal of Nematology, Volume 49 , ISSUE 1, 1–1

No Record Found..
Page Actions