Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Letter to the Editor
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • critical-appraisal
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • non-scientific
  • Obituary
  • original-paper
  • original-report
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • review-paper
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • short-communication
  • short-report
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • Journal Of Nematology

 

Research Article | 03-September-2018

Nothotylenchus andrassy n. sp. (Nematoda: Anguinidae) from Northern Iran

anus distance); and elongate, conical tail with pointed tip. Nothotylenchus andrassy n. sp. is morphologically similar to five known species of the genus, namely Nothotylenchus geraerti, Nothotylenchus medians, Nothotylenchus affinis, Nothotylenchus buckleyi, and Nothotylenchus persicus. The results of molecular analysis of rRNA gene sequences, including the D2–D3 expansion region of 28S rRNA, internal transcribed spacer (ITS) rRNA and partial 18S rRNA gene are provide for the new species.

Parisa Jalalinasab, Mohsen Nassaj Hosseini, Ramin Heydari

Journal of Nematology, Volume 50 , ISSUE 2, 219–228

research-article | 11-January-2021

On the molecular identity of Paratylenchus nanus Cobb, 1923 (Nematoda: Tylenchida)

analysis DNA was extracted from several specimens using the proteinase K protocol. DNA extraction and PCR protocols were as described by Tanha Maafi et al. (2003). The primer sets D2A (5’ – ACA AGT ACC GTG AGG GAA AGT TG – 3’) and D3B (5’ – TCG GAA GGA ACC AGC TAC TA – 3’) amplifying the D2-D3 of 28 S rRNA gene (Subbotin et al., 2006), TW81 (5’ – GTT TCC GTA GGT GAA CCT GC – 3’) and AB28 (5’ – ATA TGC TTA AGT TCA GCG GGT – 3’) amplifying ITS rRNA (Tanha Maafi et al., 2003) and COIF5 (5’ – AAT WTW GGT

Sergei A. Subbotin, Guiping Yan, Mihail Kantor, Zafar Handoo

Journal of Nematology, Volume 52 , 1–7

research-article | 25-May-2020

Description and molecular phylogeny of Mesocriconema abolafiai n. sp. (Nematoda: Criconematidae) from Iran

70 sequences as ingroups and Coslenchus rhombus (Andrássy, 1982) as outgroup (Table 4). Phylogenetic relationships of M. abolafiai n. sp. with other representatives of Criconematidae inferred from the analysis of ITS rRNA gene sequences with collapsed branches, with PP less than 50%, are given in Figure 6. In this tree, the new species clustered with an isolate of M. curvatum (MF094891) with 37 bp difference (9.2%), and in a distant position from the morphologically related species, M. ozarkiense

Hossein Mirbabaei Karani, Ali Eskandari, Reza Ghaderi, Akbar Karegar

Journal of Nematology, Volume 52 , 1–17

research-article | 30-November-2019

First report of the bent seed gall nematode, Anguina agrostis (Steinbuch, 1799) Filipjev, 1936 from Poa palustris L. in Wyoming, USA

in the flowers of grasses was required. He proposed that A. agrostis appeared to be restricted to populations causing characteristic elongate galls and abnormally elongated floral structures in grasses of the genus Agrostis. Analysis of the ITS rRNA gene sequences made by Subbotin et al. (2004) supported the concept of a narrow specialization of seed gall nematodes and showed that A. agrostis was only found on Agrostis capillaris. Other grasses previously known as hosts for A. agrostis were

Tatiana V. Roubtsova, Sergei A. Subbotin

Journal of Nematology, Volume 52 , 1–3

Research Article | 17-October-2018

Characterization of Meloidogyne indica (Nematoda: Meloidogynidae) Parasitizing Neem in India, with a Molecular Phylogeny of the Species

juveniles, males and females were carried out by light compound and scanning electron microscopy. Gross morphology and measurements were found consistent with the original description of M. indica infecting citrus by Whitehead (1968). The neem population was found to infect and reproduce on citrus. Additionally, evolutionary relationship was deduced by Maximum likelihood method using ITS rRNA, D2D3 expansion segment of 28S rRNA and mitochondrial COI sequences. Phylogenetic analyses based on these

Victor Phani, Satyapal Bishnoi, Amita Sharma, Keith G. Davies, Uma Rao

Journal of Nematology, Volume 50 , ISSUE 3, 387–398

research-article | 30-November-2020

Report of the Texas peanut root-knot nematode, Meloidogyne haplanaria (Tylenchida: Meloidogynidae) from American pitcher plants (Sarracenia sp.) in California

GAA CCT GC-3′) and AB28 (5′-ATA TGC TTA AGT TCA GCG GGT-3′) amplifying the ITS rRNA gene, NAD5F2 (5′ -TAT TTT TTG TTT GAG ATA TAT TAG-3′) and NAD5R1 (5′ -CGT GAA TCT TGA TTT TCC ATT TTT-3′) amplifying the partial mitochondrial nad5 gene, TRANAH (5′ -TGA ATT TTT TAT TGT GAT TAA-3′) and MRH106 (5′-AAT TTC TAA AGA CTT TTC TTA GT-3′) amplifying the partial mitochondrial l-rRNA gene, J3 (5′-TTT TTT GGG CAT CCT GAG GTT TAT-3′) and J4.5 (5′ -TAA AGA AAG AAC ATA ATG AAA ATG-3′) amplifying the partial

Sergei A. Subbotin

Journal of Nematology, Volume 53 , 1–7

Research Article | 03-September-2018

First Report of Carrot Cyst Nematode Heterodera carotae in Mexico: Morphological, Molecular Characterization, and Host Range Study

was made using light and scanning electron microscopy of the second stage juveniles, females, males and cysts, and the host range study, was performed with nine different plants from five families. The molecular identification was made by sequencing and analysing the ITS rRNA and partial COI genes. It was shown that using presently available molecular tools it is not possible to make an accurate differentiation of H. carotae from H. cruciferae. The host range test allowed to distinguish these

Ilia Mariana Escobar-Avila, Edgar Óliver López-Villegas, Sergei A. Subbotin, Alejandro Tovar-Soto

Journal of Nematology, Volume 50 , ISSUE 2, 229–242

research-article | 30-November-2018

Description of Hirschmanniella dicksoni n. sp. (Nematoda: Pratylenchidae) from rhizosphere soil of limpograss from Florida, USA

species, raw sequences were checked and edited manually using BioEDIT, v. 7.2.5 (Hall, 1999). Consensus sequences obtained were compared with those deposited in the GenBank database using BLAST engine search for sequence homology. The newly obtained consensus sequences were submitted to the GenBank database under accession numbers KY773577 for D2–D3 of 28S gene and KY773578 for ITS rRNA. Phylogenetic analysis To perform the phylogenetic analysis, D2–D3 LSU, ITS1-5.8S-ITS2 rDNA sequences obtained

Alemayehu W. Habteweld, Faruk Akyazi, Soumi Joseph, William T. Crow, Eyualem Abebe, Tesfamariam Mekete

Journal of Nematology, Volume 51 , 1–15

research-article | 18-March-2020

A new rare nematode Nothocriconemoides hangzhouensis n. sp. (Nematoda: Criconematidae) from Hangzhou, China

, Neobakernema and D. limitanea. Figure 7: Phylogenetic relationships of Nothocriconemoides hangzhouensis n. sp. with other criconematids species as inferred from Bayesian analysis using the ITS rRNA gene sequence dataset with the GTR + I + G model (−lnL=7727.9982; AIC = 15603.9963; freqA=0.2067; freqC=0.2560; freqG=0.2814; freqT=0.2559; R(a)=1.5781; R(b)=2.9918; R(c)=1.7856; R(d)=0.6423; R(e)=2.8799; R(f)=1.0000; Pinva=0.0460; and Shape=0.6180). Posterior probability more than 70% is given for appropriate

Munawar Maria, Wentao Miao, Ruihang Cai, Pablo Castillo, Jingwu Zheng

Journal of Nematology, Volume 52 , 1–14

research-article | 30-November-2018

Meloidogyne aegracyperi n. sp. (Nematoda: Meloidogynidae), a root-knot nematode parasitizing yellow and purple nutsedge in New Mexico

Sequence (5′-3′) Use Marker D2A ACAAGTACCGTGAGGGAAAGTTG PCR and sequencing 18S rRNA D2B TCGGAAGGAACCAGCTACTA PCR and sequencing 18S rRNA ITS1 CGTAACAAGGTAGCTGTAG PCR and sequencing ITS rRNA ITS2 TTTCACTCGCCGTTACTAAGG PCR and sequencing ITS rRNA 1618 F TTT GTA CAC AC GCC CGT CG Sequencing 18S rRNA 1421 F deg GGT CTG TGA TGC CCT WRG ATG T Sequencing 18S rRNA 546 F GGG CAA GTC TGG TGC CAG CAG Sequencing 18S rRNA Nema 28 S R AG ACT CCT TGG TCC GTG TTT CAA GA PCR 18S rRNA 983 F deg CGA

J. D. Eisenback, L. A. Holland, J. Schroeder, S. H. Thomas, J. M. Beacham, S. F. Hanson, V. S. Paes-Takahashi, P. Vieira

journal of nematology, Volume 51 , 1–16

No Record Found..
Page Actions