Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • critical-appraisal
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • non-scientific
  • Obituary
  • original-paper
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • review-paper
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • short-communication
  • short-report
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • Journal Of Nematology

 

research-article | 30-November-2020

New insights into the identity of Discolaimium dubium Das, Khan and Loof, 1969 (Dorylaimida) as derived from its morphological and molecular characterization, with the proposal of its transference to Aporcella Andrássy, 2002

. Molecular analyses of LSU rDNA sequences of three Iranian specimens of D. dubium sheds some light on the identity of this species. Their evolutionary relationships, as observed in the tree provided in Figure 4, reveal that these sequences form part of a highly supported (98%) large clade including several taxa, all of them having in common the absence of pars refringens vaginae, so confirming previous findings (Álvarez-Ortega and Peña-Santiago, 2016; Álvarez-Ortega et al., 2013; Imran et al., 2019

Nasir Vazifeh, Gholamreza Niknam, Habibeh Jabbari, Arezoo Naghavi, Reyes Peña-Santiago

Journal of Nematology, Volume 53 , 1–12

research-article | 30-November-2018

Data of an Iranian Population of L. proximus Sturhan & Argo, 1983, with taxonomic revision of L. israelensis Peneva, Orion, Shlevin, Bar-Eyal & Brown, 1998 (Nematoda: Longidoridae) and Proposal for a New Synonymy

transferred to a small drop of TE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0, QIAGEN Inc., Valencia, CA) individually on separate clean slides, and each specimen was squashed using a clean slide cover glass. The suspension was collected by adding 50 μl TE buffer. Each sample was regarded as an independent DNA sample, and stored at −20°C until used as polymerase chain reaction (PCR) template. Primers used for the PCR amplification of the D2–D3 expansion domains of the LSU rDNA were forward D2A (5

Mazdosht Giti, Leila Kashi, Majid Pedram

journal of nematology, Volume 51 , 1–11

research-article | 30-November-2020

Laimaphelenchus africanus n. sp. (Tylenchomorpha: Aphelenchoididae) from South Africa, a morphological and molecular phylogenetic study, with an update to the diagnostics of the genus

. The specimens were then transferred to two individual Eppendorf tubes containing 15 µl ddH2O and their respective DNA was extracted using the chelex-100 protocol of Rashidifard et al. (2019). The DNA samples were stored at –20°C until used for amplification. The partial sequences of the large subunit ribosomal DNA (LSU rDNA D2-D3) were amplified using forward primer D2A (5′–ACAAGTACCGTGAGGGAAAGT–3′) and reverse primer D3B (5′–TCGGAAGGAACCAGCTACTA–3′) (Nunn, 1992). The polymerase chain reaction (PCR

Farahnaz Jahanshahi Afshar, Milad Rashidifard, Joaquín Abolafia, Miloslav Zouhar, Hendrika Fourie, Majid Pedram

Journal Of Nematology, Volume 53 , 1–14

Research Article | 03-September-2018

Stauratostoma shelleyi n. gen., n. sp. (Nematoda: Rhabditida: Thelastomatidae) from Appalachian Polydesmid Millipedes (Polydesmida: Xystodesmidae)

stomatal opening formed from four flaps; greatly expanded labial disc; and eight-sectored annule-like column supporting the labial disc. Thirteen nematodes from various hosts were sequenced for 28S LSU rDNA and compared with other millipede-inhabiting nematodes. Stauratostoma shelleyi is the sister group to the few Thelastoma spp. that have been molecularly characterized using the D2–D3 expansion segments of the 28S LSU rDNA.

Gary Phillips, Robert J. Pivar, Xiocaun Sun, John K. Moulton, Ernest C. Bernard

Journal of Nematology, Volume 50 , ISSUE 2, 133–146

research-article | 13-April-2020

First molecular characterization of an Iranian population of Schistonchus caprifici (Gasparrini, 1864) Cobb, 1927 (Rhabditida; Aphelenchoidea)

supported clade of S. caprifici. This is the first molecular phylogenetic study of the species from Iran, showing D2-D3 sequences of the studied Iranian population is identical to those of the majority of previously sequenced populations. Figure 1: Bayesian 50% majority rule consensus tree inferred from D2-D3 large subunit (LSU) rDNA gene sequences of Iranian population of Schistonchus caprifici (Gasparrini, 1864) Cobb, 1927 under the GTR + I + G model. The newly generated sequences are in bold font

Hadi Karimipour Fard, Hamid Zare

Journal of Nematology, Volume 52 , 1–3

research-article | 11-March-2021

Morphological and molecular characters of Scutellonema brachyurus (Steiner, 1938) Andrássy, 1958 from South Africa

Ebrahim Shokoohi

journal of nematology, Volume 53 , 1–13

research-article | 30-November-2018

First report of Longidorus mindanaoensis Coomans, De Ley, Jimenez and De Ley, 2012 (Nematoda: Longidoridae) From a Mangrove Forest in Vietnam

D2–D3 expansion segments of LSU rDNA were amplified using the primers D2A and D3B (5′-ACAAGTACCGTGGGGAAAGTTG-3′ and 5′-TCGGAAGGAACCAGCTACTA-3′) (De Ley et al., 1999). The newly obtained sequence was compared with previously submitted sequences into the GenBank database (Altschul et al., 1997) using BLAST search. Multiple alignments were made using MUSCLE and Modeltest was used to select the best fit model in MEGA 6 (Tamura et al., 2013). MrBayes 3.2.6 (Huelsenbeck and Ronquist, 2001) in Geneious

Thi Duyen Nguyen, Huu Tien Nguyen, Thi Mai Linh Le, Neriza Nobleza, Quang Phap Trinh

journal of nematology, Volume 51 , 1–5

Article | 24-July-2017

Discopersicus n. gen., a New Member of the Family Tylenchidae Örley, 1880 with Detailed SEM Study on Two Known Species of the Genus Discotylenchus Siddiqi, 1980 (Nematoda; Tylenchidae) from Iran

SEM study of the genus. These results confirmed longitudinal amphidial aperture type on lateral sides of the lip region in genus Discotylenchus, as noted by Siddiqi while erecting the genus with D. discretus as the type species. Molecular phylogenetic analyses using partial small subunit (SSU) and large subunit (LSU) rDNA sequences revealed the affinity of the genus Discopersicus n. gen. with members of the subfamily Boleodorinae, as supported by morphological characters (mainly, the oblique

ALI YAGHOUBI, EBRAHIM POURJAM, SERGIO A LVAREZ-ORTEGA, GRACIA LIE´BANAS, MOHAMMAD REZA ATIGHI, MAJID PEDRAM

Journal of Nematology, Volume 48 , ISSUE 3, 214–221

Article | 21-July-2017

Sectonema caobangense sp. n. from Vietnam (Nematoda, Dorylaimida, Aporcelaimidae)

Sectonema caobangense sp. n. from evergreen forest soil in Vietnam is described, including scanning electron micrograph (SEM) observations and D2-D3 LSU rDNA analysis. The new species is characterized by its 3.12 to 5.80mmlong body, lip region offset by deep constriction and 21 to 23 mm broad, mural tooth 13 to 14 mm long at its ventral side, 940 to 1,112 mm long neck, pharyngeal expansion occupying 61% to 69% of total neck length, uterus a long simple tube-like structure 292 to 363

SERGIO ALVAREZ-ORTEGA, THI ANH DUONG NGUYEN, JOAQUI´N ABOLAFIA, MICHAEL BONKOWSKI, REYES PEN˜A-SANTIAGO

Journal of Nematology, Volume 48 , ISSUE 2, 95–103

research-article | 24-April-2020

Cephalenchus driekieae n. sp. (Nematoda: Tylenchidae) from South Africa, a new member of the genus with a long pharyngeal overlap

). The following primers were used for amplification and sequencing: SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R26 (CATTCTTGGCAAATGCTTTCG) (Blaxter et al., 1998) for SSU rDNA; and D2A (5´-ACAAGTACCGTGAGGGAAAGTTG-3´) and D3B (5´-TCGGAAGGAACCAGCTACTA-3´) (Subbotin et al., 2006) for D2-D3 LSU rDNA. Four microliters of PCR products were loaded on a 1% agarose gel (40 mMTris, 40 mM boric acid, and 1 mM EDTA) to check the quality of the amplified DNA. The DNA bands were stained with GelRed and visualized and

Milad Rashidifard, Gerhard Du Preez, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 52 , 1–10

research-article | 18-March-2020

Description of Seinura italiensis n. sp. (Tylenchomorpha: Aphelenchoididae) found in the medium soil imported from Italy

(synthesized by Majorbio, Shanghai, China) were used in the PCR analyses to amplify the near full-length SSU and D2-D3 expansion segments of LSU rDNA. The SSU region was amplified as two partially overlapping fragments; for the first fragment, the forward 988F (5′-CTC AAA GAT TAA GCC ATG C-3′) and reverse 1912R (5′-TTT ACG GTC AGA ACT AGG G-3′) primers were used and for the second part, the forward 1813F (5′-CTG CGT GAG AGG TGA AAT-3′) and reverse 2646R (5′-GCT ACC TTG TTA CGA CTT TT-3′) primers were used

Jianfeng Gu, Munawar Maria, Lele Liu, Majid Pedram

Journal of Nematology, Volume 52 , 1–11

research-article | 30-November-2019

Description of Deladenus brevis n. sp. (Sphaerularioidea: Neotylenchidae) from Iran: a morphological and molecular phylogenetic study

species of Deladenus was recovered from a deadwood sample of a dead forest tree collected from the forests of Golestan province, northern Iran. Thus, the present paper aims to describe the newly recovered species and resolve its phylogenetic relationships with other relevant species and genera using three SSU, LSU rDNA, and COI mtDNA markers. Materials and methods Sampling, nematode extraction, mounting, and drawing Specimens of Deladenus brevis n. sp. were obtained from the bark and rotten wood

Fariba Heydari, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 52 , 1–13

Article | 24-July-2017

Cryptaphelenchus varicaudatus n. sp. (Rhabditida: Ektaphelenchinae) from Tehran Province, Iran

of small subunit (SSU) and large subunit (LSU) rDNA D2/D3 fragments, the new species formed a clade with two currently available GenBank-derived, unspecified isolates/sequences in SSU and three other isolates/sequences in LSU trees, respectively.

MAJID PEDRAM

Journal of Nematology, Volume 49 , ISSUE 2, 223–230

research-article | 26-March-2021

Morphological and molecular characterization of Butlerius butleri Goodey, 1929 (Nematoda: Diplogastridae) from South Africa: First report

al., 2006). Following DNA extraction, the polymerase chain reaction (PCR) was carried out using an Eppendorf Mastercycler gradient thermal cycler (Eppendorf, Hamburg, Germany); more details are provided in Table 1. The amplification tube contained 12.5 μl master mix (Promega Corporation, USA), 1 μl of each of the primers (i.e. forward and reverse), 5 μl DNA, and 5.5 μl ddH2O. Table 1. Polymerase chain reaction steps used for amplification of the SSU and LSU rDNA genes. 35 cycles

Chantelle Girgan, Gerhard Du Preez, Hendrika Fourie, Milad Rashidifard

Journal of Nematology, Volume 53 , 1–12

Research Article | 17-October-2018

Description of Aphelenchoides giblindavisi n. sp. (Nematoda: Aphelenchoididae), and Proposal for a New Combination

morphometric data ranges. The morphological features and morphometrics of the second studied species, A. helicus, agreed well with the data given for the type population. However, detailed study of fresh females revealed it has three drop-shaped stylet knobs and long PUS, making it typologically similar to the genus Robustodorus, meriting its taxonomic revision, i.e., transferring to it. In molecular phylogenetic analyses using partial small and large subunit ribosomal RNA gene (SSU and LSU rDNA) sequences

Farzad Aliramaji, Ebrahim Pourjam, Sergio Álvarez-Ortega, Farahnaz Jahanshahi Afshar, Majid Pedram

Journal of Nematology, Volume 50 , ISSUE 3, 437–452

research-article | 25-May-2020

Morphological and molecular characterization of Ektaphelenchoides pini (Massey, 1966) Baujard, 1984 (Aphelenchoididae; Ektaphelenchinae) from Iran, with morphological and taxonomic observations on some species

´) (Dorris et al., 2002) and reverse primer 18S 1573R (5´-TACAAAGGGCAGGGACGTAAT-3´) (Mullin et al., 2005) (the several primers designed to amplify this fragment, e.g. two pairs designed by Holterman et al., 2006 did not yield on high-quality amplifications, or yield on no amplifications). The D2–D3 expansion segments of LSU rDNA were amplified using the forward D2A (5´-ACAAGTACCGTGAGGGAAAGT-3´) (Nunn, 1992) and reverse primer 1006R (5´-GTTCGATTAGTCTTTCGCCCCT-3´) (Holterman et al., 2008). The ITS1 region

Fariba Heydari, Majid Pedram

Journal of Nematology, Volume 52 , 1–12

research-article | 01-April-2021

First record of Oscheius myriophilus (Poinar, 1986) (Rhabditida: Rhabditidae) from Iran; and its efficacy against two economic forest trees pests, Cydalima perspectalis (Walker, 1859) (Lepidoptera: Crambidae) and Hyphantria cunea (Drury, 1773) (Lepidoptera: Erebidae) in laboratory condition

(Fadakar et al., 2020). Three DNA samples were prepared in this way. The DNA samples were stored at −20°C until used in polymerase chain reaction (PCR). The PCR to amplify the partial SSU and D2-D3 expansion segments of LSU rDNA was carried out in a total volume of 35 μl (12.1 μl distilled water, 17.5 μl Taq 2X PCR Master Mix, AMPLIQON, Denmark, 1.2 μl of each primers and 3 μl DNA template). The partial SSU rDNA was amplified using the forward primer F22 (5’–TCCAA GGAAGGCAGCAGGC–3’) (Dorris et al

Reihaneh Gholami Ghavamabad, Ali Asghar Talebi, Mohammad Mehrabadi, Mohammad Ebrahim Farashiani, Majid Pedram

Journal of Nematology, Volume 53 , 1–16

research-article | 30-November-2020

An interesting rare tylenchid species, Antarctenchus urmiensis n. sp. (Tylenchomorpha; Psilenchidae) from Urmia Lake islands, northwest Iran, with a discussion on the taxonomy of related genera

forward primer 22F (5´–TCCAAGGAAGGCAGCAGGC–3´) and revers primer 13R (5´–GGGCATCACAGACCTGTTA–3´) (Dorris et al., 2002). Sometimes the reverse primer 1573 R (5´–TACAAAGGGCAGGGACGTAAT–3´) (Mullin et al., 2005) was used interchangeably. The LSU rDNA D2-D3 expansion segments were amplified using the forward D2A (5´–ACAAGTACCGTGAGGGAAAGTTG–3´) and reverse D3B (5’–TCGGAAGGAACCAGCTACTA–3´) (Nunn, 1992) primer pairs. The PCR products were sequenced in both directions using the same primers used in PCR with an

Mohammad Amiri Bonab, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 53 , 1–14

No Record Found..
Page Actions