Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • critical-appraisal
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • non-scientific
  • Obituary
  • original-paper
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • review-paper
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • short-communication
  • short-report
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • Polish Journal Of Microbiology
  • Journal Of Nematology
  • Advancements Of Microbiology
  • Acta Neurobiologiae Experimentalis

 

research-article | 30-November-2018

The morphological characteristics and phylogenetic analysis of Pratylenchus vulnus Taiwan strawberry isolate

the Pv-KDL from P. kumamotoensis (GenBank accession: KT175521.1) clearly with a very low 86.22% similarity. Phylogenetic analysis of the rDNA ITS and LSU regions combined suggested the nematodes from the two fields belong to one population (Fig. 2) and are isolated from the rest of the previous populations from other geographic regions (Table 2). Table 1. GenBank sequence deposit information of multiple gene regions of P. vulnus Taiwan isolates from strawberry fields GS and KDL. P

Yu-po Lin, Wan-chun Lee, Pei-che Chung, Jiue-in Yang

Journal of Nematology, Volume 51 , 1–5

research-article | 06-June-2019

Phylogenetic studies on three Helicotylenchus species based on 28S rDNA and mtCOI sequence data

Spiral nematodes, which belong to the Helicotylenchus spp. (Hoplolaimidae), are representatives of Tylenchomorpha, which is considered the most successful lineage of plant parasitic nematodes. They evolved by gradual transitions from fungal feeders through facultative plant parasites toward obligatory plant parasites (Holterman et al., 2017). Furthermore, the phylogenetic tree of this group reveals main evolutionary pathways, leading from ectoparasitism or migratory endoparasitism to the most

K. Rybarczyk-Mydłowska, E. Dmowska, K. Kowalewska

Journal of Nematology, Volume 51 , 1–17

Article | 04-December-2017

A New Species of the Rare Genus Anguillonema Fuchs, 1938 (Nematoda: Hexatylina, Sphaerularioidea) with Its Molecular Phylogenetic Study

monodelphic-prodelphic reproductive system, 15 to 19 mm long conical tail with broad rounded tip, and males absent. The new species is compared with two known species of the genus, Anguillonema poligraphi and A. crenati. Molecular phylogenetic studies of the new species using partial sequences of small subunit (SSU) rDNA revealed that it forms a clade with an unidentified nematode species and two species of the genus Howardula. In phylogenetic analyses using partial sequences of the 28S rDNA (D2-D3

MAHYAR MOBASSERI, MAJID PEDRAM, EBRAHIM POURJAM

Journal of Nematology, Volume 49 , ISSUE 3, 286–294

research-article | 01-April-2021

First record of Oscheius myriophilus (Poinar, 1986) (Rhabditida: Rhabditidae) from Iran; and its efficacy against two economic forest trees pests, Cydalima perspectalis (Walker, 1859) (Lepidoptera: Crambidae) and Hyphantria cunea (Drury, 1773) (Lepidoptera: Erebidae) in laboratory condition

–136.3) – – – – – – SW%= (Spicules length/Anal body diam.) ×100 137.8 ± 8.2 – – – – – – – – (126.6–150.0) – – – – – – – – GS%=(Gubernaculum length/Spicules length)×100 45.1 ± 2.5 – – – – – – – – (41.6–48.8) – – – – – – – – Molecular methods and phylogenetic analyses For molecular studies, a single live nematode specimen was transferred to 20 μl of TE buffer (10 mM Tris-Cl, 0.5 mM EDTA, pH 9.0; Qiagen) on a clean slide, heat killed, photographed and squashed using a clean slide cover

Reihaneh Gholami Ghavamabad, Ali Asghar Talebi, Mohammad Mehrabadi, Mohammad Ebrahim Farashiani, Majid Pedram

Journal of Nematology, Volume 53 , 1–16

research-article | 30-November-2019

Oostenbrinkia pedrami n. sp. (Dorylaimida: Aulolaimoididae) from Iran, with molecular phylogenetic relationships to some other Dorylaimida Pearse, 1942

natural forests of Mazandaran province in north Iran. The comparisons with two currently valid species under the genus revealed that it belongs to an unknown species, described herein as Oostenbrinkia pedrami n. sp. The molecular phylogenetic analysis for the new species, as the first representative of the family, was also performed. Materials and methods Sampling, nematode extraction, mounting, and drawing Several soil samples were collected from natural forests and grasslands of Mazandaran

Farahnaz Jahanshahi Afshar

Journal of Nematology, Volume 52 , 1–7

research-article | 30-November-2019

Description of Deladenus brevis n. sp. (Sphaerularioidea: Neotylenchidae) from Iran: a morphological and molecular phylogenetic study

species of Deladenus was recovered from a deadwood sample of a dead forest tree collected from the forests of Golestan province, northern Iran. Thus, the present paper aims to describe the newly recovered species and resolve its phylogenetic relationships with other relevant species and genera using three SSU, LSU rDNA, and COI mtDNA markers. Materials and methods Sampling, nematode extraction, mounting, and drawing Specimens of Deladenus brevis n. sp. were obtained from the bark and rotten wood

Fariba Heydari, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 52 , 1–13

Article | 21-July-2017

Description of Enchodorus yeatsi n. sp. (Dorylaimida, Nordiidae) from Southern Iran and Its Molecular Phylogenetic Study

sequences of 28S rDNA D2/D3 and internal transcribed spacer 1 (ITS1) fragments. Compared to Enchodorus neodolichurus, it has basic differences in tail characters and spicule lengths. Molecular phylogenetic studies using partial sequences of 28S rDNA D2/D3 fragment of the new species and available sequences of Nordiidae members and several other dorylaim species/genera, revealed E. yeatsi n. sp. and E. dolichurus forming a clade with 0.81 Bayesian posterior probability (BPP). This

MAJID PEDRAM

Journal of Nematology, Volume 49 , ISSUE 1, 21–26

Article | 04-December-2017

Description of a New Anguinid Nematode, Nothotylenchus phoenixae n. sp. (Nematoda: Anguinidae) Associated with Palm Date Trees and Its Phylogenetic Relations within the Family Anguinidae

of the partial 18S and 28S D2/D3 regions confirmed the close phylogenetic relationship between N. phoenixae n. sp. and other anguinids, but Nothotylenchus is clearly separated from Ditylenchus species and should be considered as a valid genus.

MEHRAB ESMAEILI, RAMIN HEYDARI, WEIMIN YE

Journal of Nematology, Volume 49 , ISSUE 3, 268–275

research-article | 30-November-2019

Molecular identification of Bursaphelenchus cocophilus associated to oil palm (Elaeis guineensis) crops in Tibu (North Santander, Colombia)

; Silva et al., 2016). However, to date in Colombia no molecular characterization or phylogenetic analysis of B. cocophilus from oil palm has been performed. In Tibu, oil palm plants with symptoms similar to those induced by the disease known as the red ring had been eliminated, to prevent their spread. However, palm growers have observed that some plants remain diseased for a longer time without showing the severity of the disease, so there is doubt about the diagnosis and identity of the causal

Greicy Andrea Sarria, Donald Riascos-Ortiz, Hector Camilo Medina, Yuri Mestizo, Gerardo Lizarazo, Francia Varón De Agudelo

Journal of Nematology, Volume 52 , 1–12

Article | 21-July-2017

New Cyst Nematode, Heterodera sojae n. sp. (Nematoda: Heteroderidae) from Soybean in Korea

HEONIL KANG, GEUN EUN, JIHYE HA, YONGCHUL KIM, NAMSOOK PARK, DONGGEUN KIM, INSOO CHOI

Journal of Nematology, Volume 48 , ISSUE 4, 280–289

research-article | 24-April-2020

Mitochondrial COI gene is valid to delimitate Tylenchidae (Nematoda: Tylenchomorpha) species

model was estimated using AIC in jModelTest v. 2.1.2 (Darriba et al., 2012). Maximum likelihood (ML) and Bayesian inference (BI) was performed at the CIPRES Science Gateway (Miller et al., 2010) using RAxML 8.1.11 (Stamatakis et al., 2008) and MrBayes 3.2.3 (Ronquist et al., 2012), respectively. ML analysis included 1,000 bootstrap (BS) replicates under the GTRCAT model. Bayesian phylogenetic analysis was carried out using the GTR + I + G model, analyses were run for 5 × 106 generations and Markov

Mengxin Bai, Xue Qing, Kaikai Qiao, Xulan Ning, Shun Xiao, Xi Cheng, Guokun Liu

Journal of Nematology, Volume 52 , 1–12

research-article | 30-November-2019

Intraspecific variation in phenotypic and phylogenetic features among Pratylenchus penetrans isolates from Wisconsin, USA

were (i) to assess the extent of intraspecific variability in P. penetrans in Wisconsin by comparing 13 populations of P. penetrans for morphological variation and 52 populations for sequence variation in the COI mitochondrial gene, and (ii) to determine the extent of diversity in COI for P. penetrans by combining our data with published COI sequences from populations around the world in phylogenetic and haplotype analyses. Materials and methods Nematode isolates Nematodes were recovered from

Kanan Saikai, Ann E. MacGuidwin

Journal of Nematology, Volume 52 , 1–17

Article | 21-July-2017

Data on Some Species of the Genus Coslenchus Siddiqi, 1978 (Rhabditida, Tylenchidae) from Iran

Data on five known species of the genus Coslenchus are provided. Morphological and morphometric data are given for all studied species. Three of the recovered species were also characterized by molecular phylogenetic data. The species C. leiocephalus was studied for the first time since its original description. Males of the species, C. franklinae and C. oligogyrus were described for the first time and the species C. oligogyrus was reported from Iran for the first time. In molecular

YOUSEF PANAHANDEH, EBRAHIM POURJAM, MAJID PEDRAM

Journal of Nematology, Volume 48 , ISSUE 4, 268–279

research-article | 30-March-2020

Characterization of Vittatidera zeaphila (Nematoda: Heteroderidae) from Indiana with molecular phylogenetic analysis of the genus

new sequences from cloned Hsp90 of V. zeaphila (MK580824-MK580829), Heterodera avenae (MH484608, MH484609, and MH484611), and the outgroup Helicotylenchus digonicus (MK580830). Phylogenetic inference and tree visualization Raw sequence reads were processed in Sequencher 5.4.6 (Genecodes, Inc., Ann Arbor, MI). Multiple DNA sequence alignments were created using Geneious Prime 2019.0.3 (www.geneious.com) with built-in parameters or the MAFFT plug-in, with auto-selection of best algorithm depending

Andrea M. Skantar, Zafar A. Handoo, Mihail R. Kantor, Lynn K. Carta, Jamal Faghihi, Virginia Ferris

Journal of Nematology, Volume 52 , 1–8

Research Article | 15-August-2017

Description and Distribution of Three Criconematid Nematodes from Hangzhou, Zhejiang Province, China

Populations of Criconemoides parvus, Discocriconemella hengsungica, and Discocriconemella limitanea, isolated in Hangzhou, China from the rhizosphere soil of woody perennials were characterized morphologically and molecularly. The morphometric data of the Chinese populations were compared with populations from other regions of the world. DNA barcoding with the mitochondrial COI gene confirmed conspecificity of Chinese and Costa Rican populations of D. limitanea. Phylogenetic assessment using a

Maria Munawar, Thomas O. Powers, Zhongling Tian, Timothy Harris, Rebecca Higgins, Jingwu Zheng

Journal of Nematology, Volume 50 , ISSUE 2, 183–206

Research Article | 17-October-2018

Morphological and Molecular Characterization of Labrys filiformis n. sp. (Rhabditida: Tylenchidae) from Iran

duct, offset spermatheca filled with small spheroid sperm cells, 106 to 127 µm long elongate-conoid tail with filiform distal region and finely rounded tip. Molecular phylogenetic analyses were performed using a near-full length fragment of the 18S rDNA and the D2–D3 expansion segments of the 28S rDNA using Bayesian inference and maximum likelihood methods. In the inferred phylogenetic tree with 18S rDNA, the new species has a close affinity with several isolates of the type species, Labrys

Yousef Panahandeh, Joaquín Abolafia, Ebrahim Pourjam, Robin M. Giblin-Davis, Farahnaz Jahanshahi Afshar, Majid Pedram

Journal of Nematology, Volume 50 , ISSUE 3, 343–354

Original Paper | 30-June-2018

The Heavy-Metal Resistance Determinant of Newly Isolated Bacterium from a Nickel-Contaminated Soil in Southwest Slovakia

A bacterial isolate MR-CH-I2 [KC809939] isolated from soil contaminated mainly by high nickel concentrations in southwest Slovakia was previously found carrying nccA-like heavy-metal resistance determinant, marked as MR-CH-I2-HMR [KF218096]. According to phylogenetic analysis of short (696 bp) 16S rDNA (16S rRNA) sequences this bacterium was tentatively assigned to Uncultured beta proteobacterium clone GC0AA7ZA05PP1 [JQ913301]. nccA-like gene product was on the same base of its partial (581 bp

MATEJ REMENÁR, ANNA KAMLÁROVÁ, JANA HARICHOVÁ, MARCEL ZÁMOCKÝ, PETER FERIANC

Polish Journal of Microbiology, Volume 67 , ISSUE 2, 191–201

research-article | 06-November-2020

Morphological and molecular characterizations of Heterodera oryzae in Korea

. Species identification using morphological characters alone is very difficult and does not give correct results. A combination of both morphological and molecular approaches is very crucial for proper and accurate identification (Subbotin et al., 2015). The use of mitochondrial DNA cytochrome c oxidase subunit I (mtCOI) gene, ITS region, and D2-D3 expansion segments of 28S rDNA region sequences are trending today in molecular and phylogenetic studies (Hajibabaei et al., 2007; Subbotin et al., 2007

Rose Mwesige, Eun-Hwa Kim, Eun-Hyung Park, Hyoung-Rai Ko

Journal of Nematology, Volume 52 , 1–12

Research Article | 31-May-2018

Delatylus andersoni n. gen., n. sp. (Nematoda: Neotylenchidae) Isolated from White Pine (Pinus monticola) Lumber from USA and Intercepted in Ningbo, China

Three populations of neotylenchid nematodes were isolated in Ningbo, P. R. China, from white pine lumber (Pinus monticola) imported from the USA. The nematodes were morphologically intermediate between Hexatylus and Deladenus. The nematodes were molecularly characterized based on sequences of the rDNA small subunit 18S, large subunit 28S D2/D3, and internal transcribed spacer sequences. The phylogenetic inferences placed the nematodes with other neotylenchid nematodes, i.e., Fergusobia and

Qing Yu, Maria Munawar, Jianfeng Gu, Weimin Ye

Journal of Nematology, Volume 50 , ISSUE 1, 69–76

Original Paper | 28-June-2017

The Diversity, Growth Promoting Abilities and Anti-microbial Activities of Bacteria Isolated from the Fruiting Body of Agaricus bisporus

Agaricus bisporus plays an important role in ecological processes and is one of the most widely cultivated mushrooms worldwide. Mushroom growth-promoting bacteria have been isolated from casing soil and compost, but microorganisms in the fruiting body have received only a little attention. To get an overview of phylogenetic diversity of microorganisms in the fruiting body of A. bisporus, as well as to screen antimicrobial and mushroom growth-promoting strains, and eventually intensify mushroom

Quanju Xiang, Lihua Luo, Yuhuan Liang, Qiang Chen, Xiaoping Zhang, Yunfu Gu

Polish Journal of Microbiology, Volume 66 , ISSUE 2, 201–207

research-article | 25-May-2020

Description and molecular phylogeny of Mesocriconema abolafiai n. sp. (Nematoda: Criconematidae) from Iran

manufacturer’s instruction and used for direct sequencing. The PCR products were sequenced in both directions (BioNeer Inc., Korea). The newly obtained sequences of the new species were submitted to GenBank database under accession numbers MN334221 for the 18S, MN334222 for the 28S D2-D3, and MN334228 for the ITS sequences. Phylogenetic analysis The sequences of the studied specimens were compared with sequences of other taxa in GenBank, and then, the closest sequences were selected for phylogenetic

Hossein Mirbabaei Karani, Ali Eskandari, Reza Ghaderi, Akbar Karegar

Journal of Nematology, Volume 52 , 1–17

research-article | 02-April-2019

Description of Oscheius indicus n. sp. (Rhabditidae: Nematoda) from India

using gene-specific primers and sent for sequencing by using forward and reverse M13 primers. The forward and reverse sequences were manually edited for quality, aligned using ClustalW, and a consensus sequence was generated using BioEdit v.7.2.6 (Tom Hall, NCSU, USA). The phylogenetic analysis of the ITS and 28S D2/D3 sequences were carried out as described (Ye et al., 2018). In brief, the new and previously published sequences for each gene were aligned using ClustalW in MEGAX (Kumar et al., 2018

Puneet Kumar, Wajih Jamal, Vishal S. Somvanshi, Khushbu Chauhan, Sabia Mumtaz

Journal of Nematology, Volume 51 , 1–11

research-article | 18-March-2020

Description of Seinura italiensis n. sp. (Tylenchomorpha: Aphelenchoididae) found in the medium soil imported from Italy

isolated by the modified Baermann funnel technique for 24 hr. Permanent slides were prepared by heat-killed and fixed nematodes with FA 4:1 and ethanol-glycerin dehydration according to Seinhorst (1959) as modified by De Grisse (1969). Morphometrics, drawings, and light micrographs of nematodes were done with the aid of a Zeiss microscope equipped with a Zeiss AxioCam MRm CCD camera. Molecular and phylogenetic analyses DNA samples were prepared according to Li et al. (2008). Three sets of primers

Jianfeng Gu, Munawar Maria, Lele Liu, Majid Pedram

Journal of Nematology, Volume 52 , 1–11

research-article | 30-November-2018

A draft genome for a species of Halicephalobus (Panagrolaimidae)

valid species binomial to this or other species of the genus is not infallible. Indeed, taxonomic revision of this genus will rely on molecular data (Nadler et al., 2003), interpreted in terms of evolutionary or phylogenetic species concepts (e.g., Borgonie et al., 2011). Based on bionomic evidence, specifically the nematodes’ colonization of rotting wood, the sequenced isolate herein would be best assigned to H. similigaster, a morphospecies known from Europe (Andrássy, 1952; Köhler, 2011). However

Erik J. Ragsdale, Georgios Koutsovoulos, Joseph F. Biddle

journal of nematology, Volume 51 , 1–4

research-article | 25-May-2020

Morphological and molecular characterization of Ektaphelenchoides pini (Massey, 1966) Baujard, 1984 (Aphelenchoididae; Ektaphelenchinae) from Iran, with morphological and taxonomic observations on some species

and the general morphology of the adults corroborated it belongs to the type species of the genus, E. pini. Thus, the aims of the present study were to characterize Iranian population of this species from Iran and discuss its morphological differences/similarities compared to available data and discuss its phylogenetic affinities. Furthermore, new taxonomic and morphological findings related with some other species of the genus are presented and discussed. Materials and methods Nematode

Fariba Heydari, Majid Pedram

Journal of Nematology, Volume 52 , 1–12

research-article | 13-April-2020

First molecular characterization of an Iranian population of Schistonchus caprifici (Gasparrini, 1864) Cobb, 1927 (Rhabditida; Aphelenchoidea)

previous study by Gulcu et al. (2008), a 0 to 13 different nucleotides range was observed between different populations of the species from Turkey. The genetic distance between selected D2-D3 sequences of S. caprifici calculated using MEGA6 (Tamura et al., 2013) ranged from 0.001 (between EU287679 and EU287653) to 4.90 (between EU287692 and GU190765). In the Bayesian phylogenetic tree inference under the GTR + I + G evolutionary model (Fig. 1), the newly generated sequences fell into the maximally

Hadi Karimipour Fard, Hamid Zare

Journal of Nematology, Volume 52 , 1–3

research-article | 30-November-2020

Description of Longidorella (Saevadorella) caspica n. sp. (Dorylaimida: Nordiidae) from north Iran

. Thus, the present study aims to describe and illustrate the new species, and unravel its phylogenetic relationships with other spices. Materials and methods Sampling, extracting, mounting, and drawing Several soil samples were collected from north Iran close to Caspian Sea during 2014. The new species was recovered from soil of grasses, using the tray method (Whitehead and Hemming, 1965). They were handpicked under a Nikon SMZ1000 stereomicroscope, heat-killed by adding boiling 4% formalin

Fariba Heydari, Mohammad Reza Atighi, Ebrahim Pourjam, Majid Pedram

Journal of Nematology, Volume 53 , 1–11

research-article | 26-March-2021

First report on molecular identification of Anisakis simplex in Oncorhynchus nerka from the fish market, with taxonomical issues within Anisakidae

up of the three sibling species: A. simplex sensu stricto, A. pegreffii, and A. berlandi (Mattiucci et al., 2014). But, according to the available literature data a clear division of species (A. simplex, A. pegreffii, and A. berlandi) has been repeatedly demonstrated on phylogenetic trees reconstructed using nuclear ITS rDNA (Pekmezci et al., 2014; Tunya et al., 2020) and mitochondrial cox2 gene (Anshary et al., 2014; Barcala et al., 2018; Mattiucci et al., 2009; Setyobudi et al., 2011; Valentini

Alina E. Safonova, Anastasia N. Voronova, Konstantin S. Vainutis

Journal of Nematology, Volume 53 , 1–10

research-article | 30-November-2019

First report of Paratylenchus lepidus Raski, 1975 associated with green tea (Camellia sinensis (L.) Kuntze) in Vietnam

(www.geneious.com). The best fit model was chosen using Mega 7 and phylogenetic analysis was done following Nguyen et al. (2019c). Results and discussion Measurements n = 20 (♀♀): L = 340 ± 20 (307-371) µm, a = 25 ± 1 (22-27), b = 4.1 ± 0.3 (3.7-4.6), c = 11.5 ± 1.4 (9.8-13.8), c′ = 3.5 ± 0.4 (3.0-4.1), V% = 82 ± 1 (81-84), Lip height = 2.7 ± 0.5 (1.9-3.6) µm, Lip width = 4.9 ± 0.5 (4.2-5.9) µm, Stylet = 25 ± 1 (24-27) µm, Median bulb length = 15.2 ± 2 (12.8-18.0) µm, Median bulb width = 6.9 ± 0.6 (5.9-7.7

Thi Mai Linh Le, Huu Tien Nguyen, Thi Duyen Nguyen, Quang Phap Trinh

Journal of Nematology, Volume 52 , 1–4

research-article | 30-November-2019

Hemicycliophora ahvasiensis n. sp. (Nematoda: Hemicycliophoridae), and data on a known species, from Iran

Gilan provinces, Iran. The relevant information of the presently studied nematode populations, and those included in phylogenetic analyses, are given in Table 1. Jenkins’ method (Jenkins, 1964) was used to extract the nematodes from soil samples. The collected specimens were killed in hot 4% formaldehyde solution and transferred to anhydrous glycerin according to De Grisse (1969). Observations and measurements were conducted using a Leitz SM-LUX light microscope equipped with a drawing tube. Some of

Sedighe Azimi, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 52 , 1–19

Original Paper | 04-September-2018

Biochemical and Molecular Characterization of a Native Haloalkalophilic Tolerant Strain from the Texcoco Lake

In the last decade several new genera have been isolated in alkaline and halophile growth conditions. The studies conducted in the Texcoco Lake soils have shown a generalized microbial adaptation to the specific conditions. In this research work, morphological and phylogenetic characterization of the HN31(22) strain that was isolated from the cited soil is presented. The strain was identified as a Gram-positive halophile and alkaline tolerant bacteria from the Nesterenkonia genus, which uses

MARISELA YADIRA SOTO-PADILLA, PABLO GORTÁRES-MOROYOQUI, LUIS ALBERTO CIRA-CHÁVEZ, MARÍA ISABEL ESTRADA-ALVARADO

Polish Journal of Microbiology, Volume 67 , ISSUE 3, 377–382

Research Article | 17-October-2018

Two New Species of Pristionchus (Nematoda: Diplogastridae) from Taiwan and the Definition of the pacificus Species-Complex Sensu Stricto

Pristionchus pacificus Sommer, Carta, Kim, and Sternberg, 1996 is an important model organism in evolutionary biology that aims to integrate developmental biology and evo-devo with population genetics and ecology. Functional studies in P. pacificus are supported by a well-established phylogenetic framework of around 30 species of the genus Pristionchus that have been described in the last decade based on their entomophilic and necromenic association with scarab beetles. Biogeographically, East

Kohta Yoshida, Matthias Herrmann, Natsumi Kanzaki, Christian Weiler, Christian Rödelsperger, Ralf J. Sommer

Journal of Nematology, Volume 50 , ISSUE 3, 355–368

original-paper | 28-June-2019

An Investigation of Petrol Metabolizing Bacteria Isolated from Contaminated Soil Samples Collected from Various Fuel Stations

://www.clustal.org/mbed.tgz. Results of multiple sequence alignment analysis were used to construct bootstrapped maximum composite likelihood neighbor-joining trees using Mega 7 software. Table I Phylogenetic analysis of petrol metabolizing bacteria. Group Isolate Accession No. Closest phylogenetic relative Similarity URLs Group I IUBP2 MH023312 Brevibacillus formosus strain NBRC 15716 100% https://www.ncbi.nlm.nih.gov/nuccore/MH023312.1 IUBP3 MH023313 Brevibacillus formosus strain NBRC 15716

FATIMA MUCCEE, SAMINA EJAZ

Polish Journal of Microbiology, Volume 68 , ISSUE 2, 193–201

research-article | 30-November-2019

First report of Xiphinema hunaniense Wang & Wu, 1992 (Nematoda: Longidoridae) in Vietnam

phylogenetic tree showed that 28S rDNA sequences of the Vietnamese population of X. hunaniense were placed together with sequences of X. hunaniense from other populations (100% PP) and this group has a sister relationship (73% PP) to the sequences of X. brasiliense (Fig. 2). When it comes to morphology, X. hunaniense is closest to X. radicicola, and therefore, it has been synonymized with X. radicicola by Loof et al. (1996). However, based on the observation of different populations of X. hunaniense and X

Huu Tien Nguyen, Thi Duyen Nguyen, Thi Mai Linh Le, Quang Phap Trinh

Journal of Nematology, Volume 52 , 1–4

Short Communication | 27-September-2017

Genetic Characterization of Human Enteroviruses Associated with Hand, Foot and Mouth Diseases in Poland, 2013–2016

The objective of the present study was to describe the molecular characteristics of enteroviruses associated with hand, food, and mouth disease (HFMD) in Poland. Clinical material from HFMD cases, that occurred during 2013–2016 were examined. It has been showed that coxsackievirus A6 (CVA6), CVA10 and CVA16 were circulating in the country. Phylogenetic analysis showed that Polish CVA6 strains were divided into two distinct clusters suggesting two independent introductions. This is the

Magdalena Wieczorek, Agnieszka Ciąćka, Arleta Krzysztoszek, Agnieszka Figas, Leszek Szenborn

Polish Journal of Microbiology, Volume 66 , ISSUE 3, 405–409

Short Communication | 04-September-2018

Gut Microbial Compositions in Four Age Groups of Tibetan Minipigs

In this study, the gut microbiota was characterized in four age strata of Tibetan minipigs. Results indicated that the fecal bacteria of 7-, 28-, 56-, and 180-day-old minipigs did not significantly differ in terms of phylogenetic diversity (i.e., PD whole tree) or the Shannon index (both, p > 0.05). Findings of a principal coordinate analysis demonstrated that fecal bacteria of 180-day-old minipigs were discernable from those of the other three age groups. From ages seven to 56 days, the

XIA JIANG, BANGZHU CHEN, DONGSHU GU, ZUHUA RONG, XIAOHUA SU, MIN YUE, HONGWEI ZHOU, WEIWANG GU

Polish Journal of Microbiology, Volume 67 , ISSUE 3, 383–388

research-article | 30-November-2020

First report of Mesocriconema sphaerocephalum (Taylor, 1936) Loof, 1989 associated with wild grass in Botswana

hot 4% formaldehyde solution and transferred to anhydrous glycerin using the De Grisse (1969) method. The classification provided by Geraert (2010) was used for the taxonomical study of Mesocriconema. Pictures were taken with a Nikon Eclipse 80i light microscope provided with differential interference contrast optics (DIC) and a Nikon Digital Sight DS-U1 camera (Nikon, Tokyo, Japan). Micrographs were edited using Adobe® Photoshop® CS. DNA extraction, PCR, and phylogenetic analysis DNA

Ebrahim Shokoohi

Journal of Nematology, Volume 53 , 1–5

research-article | 30-November-2018

Morpho-molecular characterization of Colombian and Brazilian populations of Rotylenchulus associated with Musa spp

address this knowledge gap, the present study aims to: identify by morphological, morphometric, and molecular analysis the species of Rotylenchulus associated with Musa spp. in Colombia, and analyze the phylogenetic relationship of Rotylenchulus species. Materials and methods Sampling, extraction, morphological, and morphometric analyses of nematodes Soil and root samples of banana and plantain were collected from farms in Bolo and Rozo (Palmira, Valle del Cauca, Colombia) and Minas Gerais (Brazil

Donald Riascos-Ortiz, Ana Teresa Mosquera-Espinosa, Francia Varón De Agudelo, Claudio Marcelo Gonçalves de Oliveira, Jaime Eduardo Muñoz-Flórez

Journal of Nematology, Volume 51 , 1–13

research-article | 30-November-2020

A draft transcriptome of a parasite Neocamacolaimus parasiticus (Camacolaimidae, Plectida)

Mohammed Ahmed, Funmilola Adedidran, Oleksandr Holovachov

Journal of Nematology, Volume 53 , 1–4

Research Article | 03-September-2018

Description of Longidorus azarbaijanensis n. sp. (Dorylaimida: Longidoridae) from Iran

. sturhani. The morphological differences of the new species with the aforementioned species are discussed. For all the aforementioned species (except L. protae, currently lacking molecular data) the differences of the new species was also confirmed with differences in molecular sequences of D2-D3 expansion domains of 28S rDNA and the corresponding phylogenetic analyses. The partial sequence of the internal transcribed spacer 1 (ITS1) of the new species was also used in phylogenetic analyses. In partial

Farshad Gharibzadeh, Ebrahim Pourjam, Majid Pedram

Journal of Nematology, Volume 50 , ISSUE 2, 207–218

research-article | 30-November-2019

Morphological and molecular characterization of Heterodera dunensis n. sp. (Nematoda: Heteroderidae) from Gran Canaria, Canary Islands

://www.geneious.com) and deposited in GenBank. Phylogenetic analysis The phylogenetic relationships of the new species with other related species were analyzed based on the D2-D3, ITS, 18S, and COI sequences. Phylogenetic programs implemented in Geneious Prime 2020.0.5 were used. The obtained consensus contigs were subjected to BLAST search to check for closely related species on GenBank, and all the collected sequences for each gene fragment were aligned using MUSCLE alignment of Geneious Prime 2020.0.5 using

Phougeishangbam Rolish Singh, Gerrit Karssen, Marjolein Couvreur, Wim Bert

Journal of Nematology, Volume 52 , 1–14

research-article | 30-November-2020

Laimaphelenchus africanus n. sp. (Tylenchomorpha: Aphelenchoididae) from South Africa, a morphological and molecular phylogenetic study, with an update to the diagnostics of the genus

) was performed in the same conditions describe by Pedram (2019). The newly obtained LSU D2-D3 sequences were deposited into the GenBank database under the accession numbers MW507183 and MW507184. Phylogenetic analyses The raw file of the newly generated partial sequences of LSU rDNA of Laimaphelenchus africanus n. sp. were manually checked, edited, and compared with those of the relevant sequences available in the GenBank database using the BLAST homology search program. Sequences of several

Farahnaz Jahanshahi Afshar, Milad Rashidifard, Joaquín Abolafia, Miloslav Zouhar, Hendrika Fourie, Majid Pedram

Journal Of Nematology, Volume 53 , 1–14

research-article | 30-November-2019

First report of Meloidogyne hapla on kiwifruit in South Africa

. hapla populations, our sequence of M. hapla showed the lowest similarity, 89% with M. incognita (JX100425), M. javanica (JX100426), and M. enterolobii (KJ146862) using 28rDNA marker. Therefore, molecular result confirmed our populations as M. hapla. The phylogenetic analysis using ITS and 28S rDNA, placed the South African M. hapla population in a clade together with other M. hapla populations (Figs. 2, 3). The molecular characterization of several species of M. hapla suggested that they formed a

Ebrahim Shokoohi, Phatu W. Mashela

Journal of Nematology, Volume 52 , 1–5

research-article | 30-November-2020

Description of Prionchulus jonkershoekensis n. sp. (Nematoda: Mononchida), a new predatory species from South Africa

species was characterized using both morphological and molecular techniques, its phylogenetic relationships are also discussed based on 18 S and 28 S rDNA genes. Materials and methods Nematode extraction and processing Prionchulus jonkershoekensis n. sp. specimens were extracted from leaf-litter samples collected from one locality in the Jonkershoek Mountains by using the Baermann tray method (Hooper and Evans, 1993). Nematodes were heat-killed and fixed using the glycerol-ethanol method of

Candice Jansen van Rensburg, Hendrika Fourie, Samad Ashrafi, Milad Rashidifard

Journal of Nematology, Volume 53 , 1–10

research-article | 26-March-2021

First report of Bitylenchus ventrosignatus (Tobar Jiménez, 1969) Siddiqi, 1986 associated with wild grass in Botswana

optics (DIC) and a Nikon Digital Sight DS-U1 camera (Nikon, Tokyo, Japan). Micrographs were edited using Adobe® Photoshop® CS. The terminology used for the morphology of stoma and spicules-gubernaculum follows the proposals by Baldwin et al. (2004) and Abolafia and Peña-Santiago (2017), respectively. DNA extraction, PCR, and phylogenetic analysis DNA extraction was done using the Chelex method (Straube and Juen, 2013). Five specimens of each species were hand-picked with a fine tip needle and

Ebrahim Shokoohi

Journal of Nematology, Volume 53 , 1–9

Research Article | 03-December-2018

Description of Gracilacus paralatescens n. sp. (Nematoda:Paratylenchinae) found from the rhizosphere of Bamboo in Zhejiang, China

slender, slightly curved and 17.5 to 18.9 µm long. In the phylogenetic analysis based on 18S, D2-D3 of 28S and ITS regions of rDNA, the new species is clustered with Paratylenchid species having longer stylet length. Morphologically, the new species belongs to Group 9 of Paratylenchus sensu lato and is most similar to G. latescens.

Munawar Maria, Ruihang Cai, Weimin Ye, Thomas O. Powers, Jingwu Zheng

Journal of Nematology, Volume 50 , ISSUE 4, 611–622

Original Paper | 10-December-2018

Aspergillus penicillioides Speg. Implicated in Keratomycosis

of the following rDNA regions: ITS1, ITS2, 5.8S, 28S rDNA, LSU and β-tubulin were carried out for the isolates studied. A high level of similarity was found between sequences from certain rDNA regions, i.e. ITS1-5.8S-ITS2 and LSU, what confirmed the classification of the isolates to the species A. penicillioides. The classification of our isolates to A. penicillioides species was confirmed also by the phylogenetic analysis.

EULALIA MACHOWICZ-MATEJKO, AGNIESZKA FURMAŃCZYK, EWA DOROTA ZALEWSKA

Polish Journal of Microbiology, Volume 67 , ISSUE 4, 407–416

research-article | 30-November-2018

Morphological and Molecular Characterization of Coslenchus paramaritus n. sp. and C. cancellatus (Cobb, 1925) Siddiqi, 1978 (Nematoda: Tylenchidae) from Iran

obtained sequences were submitted to GenBank database under accession numbers MK542004 for C. paramaritus n. sp. and MK542005 for C. cancellatus. Phylogenetic analyses For phylogenetic relationships, analyses were based on D2–D3 expansion fragments of the 28S rRNA gene sequences. The newly obtained sequences were edited and aligned with another segments of 28S rRNA gene sequences available in GenBank using MUSCLE alignment tool implemented in the MEGA7 (Kumar et al., 2016). The best-fit model of

Manouchehr Hosseinvand, Ali Eskandari, Reza Ghaderi

journal of nematology, Volume 51 , 1–10

research-article | 30-November-2019

First report of Ovomermis sinensis (Nematoda: Mermithidae) parasitizing fall armyworm Spodoptera frugiperda (Lepidoptera: Noctuidae) in China

with ABI 3730 (Suzhou Genewiz Biotechnology Co., Ltd., Tianjin, China). Sequences were aligned using Clustalw with the default settings in MEGA X software package (Kumar et al., 2018). Sequences were visually proofread, edited, and assembled into contigs in Bioedit v7.1.7 (Hall, 2012). The resulting sequences were submitted to GenBank. Sequences of mermithid from Genbank were searched and involved into the phylogenetic analysis. Pairwise distances and neighbor-joining (NJ) (Saitou and Nei, 1987

Bingjiao Sun, Fen Li, Xiaorui He, Fengqin Cao, Elizabeth Bandason, David Shapiro-Ilan, Weibin Ruan, Shaoying Wu

Journal of Nematology, Volume 52 , 1–7

research-article | 30-November-2019

Characterization of a population of Pelodera strongyloides (Nematoda: Rhabditidae) associated with the beetle Lucanus ibericus (Coleoptera: Lucanidae) from Georgia

. In the present study, a Georgian population of P. strongyloides recovered for the first time from L. ibericus and was fully characterized by morphology and morphometrics. Furthermore, the PCR amplification and sequencing of the D2 to D3 expansion domains of the 28S rRNA gene, the ITS, and the mitochondrial COI were carried out. The phylogenetic relationships of P. strongyloides from Georgia to other Pelodera species and Rhabditidae were also reconstructed. Materials and methods Nematode

O. Gorgadze, A. Troccoli, E. Fanelli, E. Tarasco, F. De Luca

Journal of Nematology, Volume 52 , 1–12

research-article | 30-November-2020

Steinernema sandneri n. sp. (Rhabditida: Steinernematidae), a new entomopathogenic nematode from Poland

same species) controls were performed. All the treatments were replicated 30 times for each combination of the nematode species and observed for 20 consecutive days at 17.5°C. Molecular characterization and phylogenetic analysis DNA was extracted from three single virgin first-generation females of nematodes using a DNeasy Blood and Tissue Kit (Qiagen, Germany). PCR amplification of the internal transcribed spacer (ITS) region of rDNA, the D2D3 region of 28 S rDNA, and the mitochondrial cox1 gene

Magdalena Lis, Ewa Sajnaga, Marcin Skowronek, Adrian Wiater, Kamila Rachwał, Waldemar Kazimierczak

Journal of Nematology, Volume 53 , 1–24

Article | 24-July-2017

Discopersicus n. gen., a New Member of the Family Tylenchidae Örley, 1880 with Detailed SEM Study on Two Known Species of the Genus Discotylenchus Siddiqi, 1980 (Nematoda; Tylenchidae) from Iran

SEM study of the genus. These results confirmed longitudinal amphidial aperture type on lateral sides of the lip region in genus Discotylenchus, as noted by Siddiqi while erecting the genus with D. discretus as the type species. Molecular phylogenetic analyses using partial small subunit (SSU) and large subunit (LSU) rDNA sequences revealed the affinity of the genus Discopersicus n. gen. with members of the subfamily Boleodorinae, as supported by morphological characters (mainly, the oblique

ALI YAGHOUBI, EBRAHIM POURJAM, SERGIO A LVAREZ-ORTEGA, GRACIA LIE´BANAS, MOHAMMAD REZA ATIGHI, MAJID PEDRAM

Journal of Nematology, Volume 48 , ISSUE 3, 214–221

research-article | 30-November-2019

An integrative approach to the study of Helicotylenchus (Nematoda: Hoplolaimidae) Colombian and Brazilian populations associated with Musa crops

knowledge of the taxonomic identity of the species of Helicotylenchus associated with Musaceae in Colombia and Brazil, the present study has the following objectives: (i) to identify the species of Helicotylenchus that are associated with banana and plantain crops, using a combination of morphological, morphometric, and molecular analysis, and (ii) to elucidate the phylogenetic relationships of Helicotylenchus species that are associated with banana and plantain crops in the departments of Quindío

Donald Riascos-Ortiz, Ana Teresa Mosquera-Espinosa, Francia Varón De Agudelo, Claudio Marcelo Gonçalves de Oliveira, Jaime Eduardo Muñoz-Florez

Journal of Nematology, Volume 52 , 1–19

research-article | 30-November-2020

Integrative taxonomy, distribution, and host associations of Geocenamus brevidens and Quinisulcius capitatus from southern Alberta, Canada

were examined morphologically and identified as Geocenamus brevidens and Quinisulcius capitatus. Because both of these are considered plant-parasitic species in other countries (Smiley et al., 2006; Thompson et al., 2008), the aim of the present study was to (i) provide a detailed molecular and morphometric characterization of both species, (ii) provide extensive information on the species distribution and host associations, and (iii) study the phylogenetic relationship of G. brevidens and Q

Maria Munawar, Dmytro P. Yevtushenko, Pablo Castillo

Journal of Nematology, Volume 53 , 1–17

Article | 21-July-2017

Morphological and Molecular Characterization of Gracilacus wuae n. sp. (Nematoda: Criconematoidea) Associated with Cow Parsnip (Heracleum maximum) in Ontario, Canada

-stage juveniles lack a stylet, the pharynx degenerated, and can be differentiated into preadult females and males based on the position of the genital primordia. The third-stage juveniles are similar to females but smaller. Phylogenetic studies using the rDNA small subunit 18S, large subunit 28S D2/D3, and internal transcribed spacer (ITS) sequences collectively provide evidence of a grouping with other Gracilacus and some species of Paratylenchus with stylet length of females longer than 41 mm

QING YU, WEIMIN YE, TOM POWERS

Journal of Nematology, Volume 48 , ISSUE 3, 203–213

Original Research | 18-July-2017

Deladenus posteroporus n. sp. (Nematoda: Neotylenchidae) Isolated from Packaging Wood from Canada and White Pine (Pinus monticola) Lumber from the United States and Intercepted in Ningbo, China

infective forms, by a broadly rounded tail end in mycetophagous females and lateral fields with 11 to 12 lines midbody in both mycetophagous females and males. The partial 18S, complete internal transcribed spacer, and partial 28S D2/D3 rRNA genes were amplified and sequenced. Phylogenetic analyses of the genes grouped the new species with previously sequenced species of Deladenus in a fully supported clade. This is the first report of Deladenus species with a known infective stage to have the excretory

Qing Yu, Jianfeng Gu, Weimin Ye, Rusong Li, Jie He

Journal of Nematology, Volume 49 , ISSUE 2, 168–176

Article | 03-December-2017

An 18S rDNA Perspective on the Classification of Criconematoidea

In the nematode family Criconematidae, a taxonomy primarily based on cuticle characters has created classifications that are notoriously volatile. Molecular characters may lead to their stabilization. A phylogenetic tree of Criconematoidea was constructed using 166 new near full-length 18S rDNA sequences and 58 sequences from GenBank. Bayesian and maximum likelihood (ML) analyses produced trees with similar topologies. Major features include a strongly supported clade that includes

THOMAS POWERS, TIMOTHY HARRIS, REBECCA HIGGINS, PETER MULLIN, KIRSTEN POWERS

Journal of Nematology, Volume 49 , ISSUE 3, 236–244

Article | 03-December-2017

Morphological, Morphometric, and Molecular Characterization of Intraspecific Variations within Indian Populations of Meloidogyne graminicola

, Samastipur grouped with M. oryzae and M. graminis. Molecular phylogenetic analysis using internal transcribed spacer (ITS) suggested that in spite of morphological differences, these populations belonged to M. graminicola.

RAJAN SALALIA, R. K. WALIA, VISHAL SINGH SOMVANSHI, PUNEET KUMAR, ANIL KUMAR

Journal of Nematology, Volume 49 , ISSUE 3, 254–267

Research Article | 17-October-2018

Characterization of Meloidogyne indica (Nematoda: Meloidogynidae) Parasitizing Neem in India, with a Molecular Phylogeny of the Species

juveniles, males and females were carried out by light compound and scanning electron microscopy. Gross morphology and measurements were found consistent with the original description of M. indica infecting citrus by Whitehead (1968). The neem population was found to infect and reproduce on citrus. Additionally, evolutionary relationship was deduced by Maximum likelihood method using ITS rRNA, D2D3 expansion segment of 28S rRNA and mitochondrial COI sequences. Phylogenetic analyses based on these

Victor Phani, Satyapal Bishnoi, Amita Sharma, Keith G. Davies, Uma Rao

Journal of Nematology, Volume 50 , ISSUE 3, 387–398

Research Article | 03-December-2018

Two nematodes (Nematoda: Diplogastridae, Rhabditidae) from the invasive millipede Chamberlinius hualienensis Wang, 1956 (Diplopoda, Paradoxosomatidae) on Hachijojima Island in Japan

juvenile Oscheius rugaoensis (Zhang et al., 2012) Darsouei et al., 2014 (Rhabditidae), and juvenile and adult Mononchoides sp. (Diplogastridae) based on images, morphometrics, and sequences of 18S and 28S rDNA. A novel short 28S sequence of a separate population of Oscheius necromenus SB218 from Australian millipedes was also included in a phylogenetic comparison of what can now be characterized as a species complex of millipede-associated Oscheius. The only other nematode associates of millipedes

L. K. Carta, W. K. Thomas, V. B. Meyer-Rochow

Journal of Nematology, Volume 50 , ISSUE 4, 479–486

Research Article | 03-December-2018

First report of Pratylenchus vulnus associated with apple in Tunisia

. Microscopic observation of females and males demonstrated the occurrence of Pratylenchusd vulnus on apple trees. The ribosomal DNA D2-D3 expansion segments of the 28S rRNA and of the Pratylenchus populations were PCR amplified and sequenced. The sequences were compared with those of Pratylenchus species in the GenBank database with high similarity (99%). This comparison reconfirmed the morphological identifications. Phylogenetic studies placed those populations with P. vulnus. This is the first report of

Noura Chihani-Hammas, Lobna Hajji-Hedfi, Hajer Regaieg, Asma Larayedh, Ahmed Badiss, Yu Qing, Horrigue-Raouani Najet

Journal of Nematology, Volume 50 , ISSUE 4, 579–586

Original Paper | 26-August-2016

Partial Characterization of Bacteriocin Produced by Halotolerant Pediococcus acidilactici Strain QC38 Isolated from Traditional Cotija Cheese

During a screening of lactic acid bacteria producing bacteriocin from Cotija cheese, the strain QC38 was isolated. Based on the 16S rRNA gene nucleotide sequencing (516 pb accession no KJ210322) and phylogenetic analysis, the isolate was identified as Pediococcus acidilactici. Neutralized cell-free supernatant was tested for antimicrobial activity against 17 Gram-negative and Gram-positive pathogens. Growth inhibition was achieved against Listeria monocytogenes (supplier or indication or source

Aurea I. Morales-Estrada, Ahidé López-Merino, Nestor Gutierrez-Mendez, Enrico A. Ruiz, Araceli Contreras-Rodríguez

Polish Journal of Microbiology, Volume 65 , ISSUE 3, 279–285

research-article | 24-April-2019

DNA barcoding evidence for the North American presence of alfalfa cyst nematode, Heterodera medicaginis

were taken with a Leica DMLB light microscope with differential interference contrast optics and a Leica DC300 video camera. All juveniles examined at the University of Nebraska were provided an identification number which links specimen images, measurements, and placement on phylogenetic trees. Cysts were prepared for scanning electron microscopy by fixation in a 4% formalin solution followed by a graded series of alcohol to 100% ethyl alcohol prior to critical point drying and coating with gold

Thomas Powers, Andrea Skantar, Tim Harris, Rebecca Higgins, Peter Mullin, Saad Hafez, Zafar Handoo, Tim Todd, Kirsten Powers

Journal of Nematology, Volume 51 , 1–17

research-article | 30-November-2018

First report of Mesocriconema xenoplax (Nematoda: Criconematidae) from turfgrass in Portugal and in Europe

identical thus only one was included in this study. The resulting D2/D3 rDNA sequence was compared against a set of reference sequences of M. xenoplax selected from GenBank (NCBI) to cover a range of species from Criconematidae. Nucleotide sequences from isolates for which GenBank sequence data were available for the homologous fragment of D2/D3 rDNA gene were retrieved and a new multiple alignment was performed, using ClustalW integrated in software MEGA 6 (Tamura et al., 2013). A phylogenetic tree was

M. L. Inácio, L. C. Rusinque, M. J. Camacho, F. Nóbrega

Journal of Nematology, Volume 51 , 1–6

research-article | 24-November-2020

Description of Heterodera microulae sp. n. (Nematoda: Heteroderinae) from China – a new cyst nematode in the Goettingiana group

diagnosis is gaining more reliability for precise and accurate identification of cyst-forming nematodes (Peng et al., 2003). The internal transcribed spacer region of the ribosomal DNA (ITS-rDNA), the D2 and D3 expansion fragments of the 28S ribosomal DNA genes (D2-D3 of 28S-rDNA), and mitochondrial DNA (COI gene) units are good candidate genes for molecular taxonomic and phylogenetic studies (Subbotin et al., 2001; Subbotin et al., 2006; Madani et al., 2004; Vovlas et al., 2017). Based on

Wenhao Li, Huixia Li, Chunhui Ni, Deliang Peng, Yonggang Liu, Ning Luo, Xuefen Xu

Journal of Nematology, Volume 52 , 1–16

original-paper | 27-December-2020

Identification and Characterization of a Novel Recombinant Porcine Astrovirus from Pigs in Anhui, China

ATCACAGCAACCCTAGGCACAGGTGCAGGTCATTTCAGCA astNFastNR Secondround TGCCTATGGTCCTCTCCAGAATCCTGCAGTGCACATCTGT 5AstWF5AstWR Firstround TGGTGGCTATGGCCCGTAGGTGCTGCCTCAAGTATGCACA 5AstNF5AstNR Secondround TGGTGGCTATGGCCCGTAGGTGGGCACAAATGGTTTGCTG 3AstWF3AstWR Firstround GCCCCGATAATGCAGGATGAOligo(dT)18 3AstNF3AstNR Secondround TATTGAAGCCTGGGATGCGGTTTTGCTCAAATTTTTAAATGC Phylogenetic analysis. The ORF1b and ORF2 amino acid sequences of Ahast and the representative sequences obtained from GenBank were selected for phylogenetic

XU CHEN, YUMIN HE, WEINA LI, ULLAH KALIM, YUQING XIAO, JIE YANG, XIAOCHUN WANG, SHIXING YANG, WEN ZHANG

Polish Journal of Microbiology, Volume 69 , ISSUE 4, 471–478

research-article | 30-November-2019

Morphological and molecular characterization of two species of Neothada Khan, 1973 (Nematoda: Tylenchidae) from Iran, with notes on N. cancellata

measured by comparison with a low DNA mass ladder (Invitrogen, Carlsbad, CA). The PCR product was purified and sequenced directly for both strands using the same primers with an ABI 3730XL sequencer (Bioneer, Seoul, South Korea). The newly obtained sequences were submitted to GenBank database under accession numbers MN970001 and MN970002 for the D2-D3 expansion fragments of 28 S sequences. Phylogenetic analyses For phylogenetic relationships, analyses were based on D2-D3 expansion fragment of 28 S

Manouchehr Hosseinvand, Ali Eskandari, Reza Ghaderi

Journal of Nematology, Volume 52 , 1–10

Article | 21-July-2017

Steinernema biddulphi n. sp., a New Entomopathogenic Nematode (Nematoda: Steinernematidae) from South Africa

DNA (rDNA). Phylogenetic data show that S. biddulphi n. sp. belongs to the ‘‘bicornutum’’ clade within the Steinernematidae family.

HARUN CIMEN, VLADIMI´R PU°zA, JIRI NERMUT, JUSTIN HATTING, TSHIMA RAMAKUWELA, SELCUK HAZIR

Journal of Nematology, Volume 48 , ISSUE 3, 148–158

Article | 21-July-2017

Description of Aphelenchoides macrospica n. sp. (Nematoda:Aphelenchoididae) from Northwestern Iran

mucronate in both sexes. Vagina directed anteriad, and spicules are relatively large (27–32 mm) with well-developed broadly rounded apex and condylus. The new species comes close to seven known species of the genus namely A. arcticus, A. blastophthorus, A. haguei, A. huntensis, A. lucknowensis, A. parasaprophilus, andA. xui, but it differs from them by the body size, stylet length, size of spicules, and length of postvulval uterine sac. The results of phylogenetic analyses

BEHROUZ GOLHASAN, RAMIN HEYDARI, MEHRAB ESMAEILI, ESMAEIL MIRAEIZ

Journal of Nematology, Volume 49 , ISSUE 1, 67–76

Research Article | 17-October-2018

Description of Xiphinema parachambersi sp. n. (Nematoda: Longidoridae) from Imported Ornamental Plants in Japan with a Key to Xiphinema Species in Group 1

rounded terminus. Only two juvenile stages were available to study and no male was found. The polytomous identification codes for this new species are A1, B4, C2, D23, E1, F2, G2, H2, I2, J2, K?, L1 and it belongs to the morphospecies group 1. Phylogenetic analysis based on the 18S, ITS1 and 28S D2/D3 sequences of the new species showed close relationships with X. chambersi. Morphologically, the new species is similar to X. chambersi, X. hangzhouense, and X. winotoi but can be differentiated by

Munawar Maria, Weimin Ye, Qing Yu, Jianfeng Gu

Journal of Nematology, Volume 50 , ISSUE 3, 369–386

research-article | 24-April-2020

First report of molecular characterization and phylogeny of Trichuris fossor Hall, 1916 (Nematoda: Trichuridae)

immunosuppression therapy (Feliu et al., 2000). A more comprehensive understanding of relationships within this group would enable predictions about how close relatives interact with their host(s). Relationships within Trichuridae have not been well resolved using genetic approaches; results differ depending on the gene(s) sequenced and the approach used for phylogenetic reconstructions (Callejón et al., 2015). Mitochondrial data, primarily cox1, have been commonly used and have allowed for high resolution of

Malorri R. Hughes, Deborah A. Duffield, Dana K. Howe, Dee R. Denver

Journal of Nematology, Volume 52 , 1–6

research-article | 28-April-2020

Morphological and molecular characterization of Acrobeloides saeedi Siddiqi, De Ley and Khan, 1992 (Rhabditida, Cephalobidae) from India and comments on its status

, respectively; MK935148 and MK935151 for ITS of DH1 and KMW, respectively. Phylogenetic analyses The sequences were edited and compared with those already present in GenBank using the basic local alignment search tool (BLAST) of the National Centre for Biotechnology Information (NCBI) (Altschul et al., 1990). An alignment of nematode samples together with sequences of related cephalobid species was produced for the LSU (D2-D3 rDNA), SSU, and ITS rDNA sequences using default Clustal W parameters in MEGA

Aasha Rana, Aashaq Hussain Bhat, Suman Bhargava, Ashok Kumar Chaubey, Joaquín Abolafia

Journal of Nematology, Volume 52 , 1–21

research-article | 30-November-2019

Morphological and molecular characterization of Hoplolaimus pararobustus (Schuurmans Stekhoven and Teunissen, 1938) Sher 1963 with its first report on Zea mays roots in Namibia

corms and roots of banana where they were likely to cause damage to the crop (Sikora et al., 2018). Phylogenetic analysis of Hoplolaimus spp. using D2–D3 expansion of 28 S and internal transcribed spacer (ITS1) ribosomal DNA sequences resolved the phylogeny of the genus and were useful in molecular identification of Hoplolaimus spp. (Bae et al., 2008). In addition, the PCR-RFLP method was applied by different researchers to evaluate the genetic diversity of Hoplolaimus spp. (Robbins et al., 2009

Mariette Marais, Esther van den Berg, Hendrika Fourie, Milad Rashidifard

Journal of Nematology, Volume 52 , 1–12

research-article | 30-November-2020

Basilaphelenchus hyrcanus n. sp. (Rhabditida: Tylaphelenchinae) associated with bark of a beech tree (Fagus orientalis Lipsky) from northern Iran

Aphelenchoididae Skarbilovich, 1947 is a diverse family that includes fungal feeders, plant parasites, insect parasites and predators (Hunt, 1993, 2008). The family is separated into six subfamilies, namely Acugutturinae Hunt, 1980; Aphelenchoidinae Skarbilovich, 1947; Ektaphelenchinae Paramonov, 1964; Entaphelenchinae Nickle, 1970; Parasitaphelenchinae Rühm, 1956, and Seinurinae Husain and Khan, 1967. The molecular phylogenetic relationships of Aphelenchoididae inferred from 18 S and 28 S D2

Behrouz Golhasan, Esmaeil Miraeiz, Zahra Tanha maafi, Ramin Heydari

Journal of Nematology, Volume 53 , 1–11

research-article | 30-November-2020

Morphological and molecular characterization of Xiphinemella esseri Chitwood, 1957 (Dorylaimida: Leptonchidae) from Florida, with the first molecular study of the genus

250D digital camera (Canon, Tokyo, Japan). Digital images were edited using Adobe® Photoshop® CS (Adobe Systems, San Jose, CA). DNA extraction, PCR, sequencing, and phylogenetic analysis DNA was extracted from single individuals using the proteinase K protocol. DNA extraction, PCR, and cloning protocols were used as described by Tanha Maafi et al. (2003). The primers used for amplification of the D2-D3 expansion segments of 28S rRNA gene were the D2A (5′-ACA AGT ACC GTG AGG GAA AGT TG-3′) and the

Sergio Álvarez-Ortega, Sergei A. Subbotin, Renato N. Inserra

Journal of Nematology, Volume 53 , 1–9

research-article | 30-November-2020

A new cyst-forming nematode, Cactodera tianzhuensis n. sp. (Nematoda:Heteroderinae) from Polygonum viviparum in China with a key to the Genus Cactodera

-rDNA of unknown species is sufficient to study the phylogenetic relationship and identify cyst-forming nematode species (Maafi et al., 2003; Subbotin et al., 2001, 2006). Up to now, the genus Cactodera contains 16 valid species and mostly parasites plants of Amaranthaceae, Cactaceae, Chenopodiae, and Polygonaceae in different regions (Escobar-Avila et al., 2020; Feng et al., 2018; Subbotin et al., 2010). To date, very little is known about the occurrence and distribution of Cactodera nematode and

Wenhao Li, Huixia Li, Chunhui Ni, Mingming Shi, Xuejuan Wei, Yonggang Liu, Yiwen Zhang, Deliang Peng

Journal of Nematology, Volume 53 , 1–15

research-article | 30-November-2020

First detection of Gongylonema species in Geotrupes mutator in Europe

course of this study, a DNA extract prepared using a formerly unidentified Gongylonema specimen, obtained from Otus scops, Spain, and analyzed in a previous study (Esperón et al., 2013), was provided by its authors in order to obtain its corresponding sequence for the cox1 barcode section (DDBJ: accession numbers LC620542). Phylogenetic analyses were carried out based on the construction of multiple alignments of nucleotide (nt) sequences either comprising a wide range of nematodes (including

Daniel Bravo-Barriga, Manuel Martín-Pérez, Jorge M. Lobo, Ricardo Parreira, Juan Enrique Pérez-Martín, Eva Frontera

Journal of Nematology, Volume 53 , 1–9

Article | 21-July-2017

Sectonema caobangense sp. n. from Vietnam (Nematoda, Dorylaimida, Aporcelaimidae)

the stoma. Molecular data obtained and the derived evolutionary trees support a close phylogenetic relationship with other Sectonema species.

SERGIO ALVAREZ-ORTEGA, THI ANH DUONG NGUYEN, JOAQUI´N ABOLAFIA, MICHAEL BONKOWSKI, REYES PEN˜A-SANTIAGO

Journal of Nematology, Volume 48 , ISSUE 2, 95–103

Article | 21-July-2017

Paurodontella parapitica n. sp. (Nematoda: Hexatylina, Sphaerularioidea) from Kermanshah Province, Western Iran

inner incisures weakly crenated, excretory pore situated 90 to 100 mmfrom anterior end; functional males common in the population, with spicules 24 to 26 mmlong. Tail of both sexes similar, almost straight and elongate-conoid. The new species resembles in morphology and morphometrics to four known species of the genus, namely P. apitica, P. minuta, P. myceliophaga, and P. sohailai. The results of phylogenetic analyses based on sequences of D2/D3 expansion region of 28S rRNA gene

MEHRAB ESMAEILI, RAMIN HEYDARI, WEIMIN YE

Journal of Nematology, Volume 48 , ISSUE 2, 109–115

Original Paper | 30-March-2017

Isolation and Characterization of Phosphate-Solubilizing Bacteria from Mushroom Residues and their Effect on Tomato Plant Growth Promotion

phylogenetic positions, strains M01 and M04 belonged to the genus Acinetobacter, and strain M11 belonged to the genus Ochrobactrum. The findings suggest that waste mushroom residues are a potential resource of plant growth-promoting bacteria exhibiting satisfactory phosphate-solubilizing for sustainable agriculture.

Jian Zhang, Pengcheng Wang, Ling Fang, Qi-An Zhang, Congsheng Yan, Jingyi Chen

Polish Journal of Microbiology, Volume 66 , ISSUE 1, 57–65

Original Paper | 30-March-2017

A Comparative Study: Taxonomic Grouping of Alkaline Protease Producing Bacilli

and the results were in concurrence with phylogenetic analyses of the 16S rRNA genes. While ITS-PCR provided the highest correlation with 16S rRNA groups, (GTG)5-PCR showed the highest differentiation at species and intra-species level. In this study, each of the biotechnologically valuable alkaline protease producing isolates was grouped into their taxonomic positions with multi-genotypic analyses.

Nilgun Tekin, Arzu Coleri Cihan, Basar Karaca, Cumhur Cokmus

Polish Journal of Microbiology, Volume 66 , ISSUE 1, 39–56

research-article | 24-April-2019

Two new Species of Pristionchus (Nematoda: Diplogastridae) include the Gonochoristic Sister Species of P. fissidentatus

The genus Pristionchus (Kreis, 1932) with the model organism P. pacificus has emerged as an important group of nematodes to study various aspects of macroevolution, including comparative developmental biology, phenotypic plasticity, evolutionary ecology, and comparative genomics (Sommer et al., 1996; Sommer, 2015). Many of these studies critically depend on deep taxon sampling and a robust phylogenetic framework (Susoy et al., 2015). The isolation of new Pristionchus species was fostered by the

Matthias Herrmann, Natsumi Kanzaki, Christian Weiler, Kohta Yoshida, Christian RÖdelsperger, Ralf J. Sommer

Journal of Nematology, Volume 51 , 1–14

research-article | 24-April-2020

Cephalenchus driekieae n. sp. (Nematoda: Tylenchidae) from South Africa, a new member of the genus with a long pharyngeal overlap

phylogenetic studies have focused specifically on Cephalenchus, investigating several aspects of its evolution including inter- and intraspecies and intragenomic variations, correlation of morphology and phylogeny and biogeography (Pereira and Baldwin, 2016; Pereira et al., 2017). During our recent surveys in South Africa, a population of Cephalenchus with a remarkably short stylet, long pharyngeal overlap, and four lines in the lateral field was recovered from the rhizosphere of grasses near a maize field

Milad Rashidifard, Gerhard Du Preez, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 52 , 1–10

research-article | 30-November-2019

Description of Deladenus gilanica n. sp. (Hexatylina: Neotylenchidae) isolated from wood of black pine in Northern Iran

partial 18S and 28S D2 to D3 rRNA gene sequences, and (ii) to investigate the phylogenetic relationships of this neotylenchid nematode within the superfamily Sphaerularioidea. Materials and methods Sampling, extraction, mounting, and drawing Soil, root, and wood samples were randomly collected from different regions of eastern forests in Guilan Province, Northern Iran during 2015. Nematodes were recovered directly from the wood samples by the Whitehead tray method (Whitehead and Hemming, 1965). The

Parisa Jalalinasab, Mehrab Esmaeili, Weimin Ye, Ramin Heydari

Journal of Nematology, Volume 52 , 1–10

research-article | 30-November-2019

Aphelenchus yinyuensis n. sp. (Tylenchina: Aphelenchoididae) found in Terminalia sp. in China

visualized by staining with ethidium bromide and products of sufficiently high quality were purified for cloning and sequencing by Invitrogen, Shanghai, China. Phylogenetic analyses The sequences of the near full-length 18S region and D2 to D3 expansion segments of 28S of A. yinyuensis n. sp. were compared with the species which shares the close phylogenetic relationship with Aphelenchus species available in GenBank. The selected sequences were aligned by MUSCLE (Edgar, 2004). The GTR + I + G model was

Gu Jianfeng, Munawar Maria, Yiwu Fang, Liu Lele, Xianfeng Chen, Bo Cai

Journal of Nematology, Volume 52 , 1–12

research-article | 11-March-2021

Morphological and molecular characters of Scutellonema brachyurus (Steiner, 1938) Andrássy, 1958 from South Africa

South Africa (Van den Berg and Heyns, 1973; Van den Berg et al., 2013). The present paper reports S. brachyurus from natural areas of South Africa. The aims of the study were (1) to study new populations of S. brachyurus using morphology, and (2) to study the phylogenetic position of South African S. brachyurus using 28 S rDNA and mtDNA. Materials and methods Nematode extraction and processing Rhizosphere soil samples were collected from the natural grass from North West and Limpopo provinces of

Ebrahim Shokoohi

journal of nematology, Volume 53 , 1–13

Article | 21-July-2017

Molecular and Morphological Characterization of Aphelenchoides fuchsi sp. n. (Nematoda: Aphelenchoididae) Isolated from Pinus eldarica in Western Iran

Shahina, category of Aphelenchoides species. Phylogenetic analysis based on small subunit (SSU) and partial large subunit (LSU) sequences of rRNA supported themorphological results.

MEHRAB ESMAEILI, RAMIN HEYDARI, MOZHGAN ZIAIE, JIANFENG GU

Journal of Nematology, Volume 48 , ISSUE 1, 34–42

Article | 21-July-2017

Oscheius microvilli n. sp. (Nematoda: Rhabditidae): A Facultatively Pathogenic Nematode from Chongming Island, China

, joins together anterior to the spicules, and is partially extended and decorated with microvilli. The spicules are incompletely separated, and the tail does not extend beyond the bursa. Phylogenetic trees of 18S rDNA and internal transcribed spacer indicate that the new species belongs to the insectivora group of the genus Oscheius; it is most closely related to O. myriophilus, and the two species can be distinguished on the basis of their different body length, morphological

GUIXIN ZHOU, HUAN YANG, FENG WANG, HAORAN BAO, GUOXIANG WANG, XIANGLONG HOU, JIAN LIN, GABRIEL YEDID, KEYUN ZHANG

Journal of Nematology, Volume 49 , ISSUE 1, 33–41

Research Article | 03-September-2018

Morphological Re-Description and 18 S rDNA Sequence Confirmation of the Pinworm Aspiculuris tetraptera (Nematoda, Heteroxynematidae) Infecting the Laboratory Mice Mus musculus

study. Molecular characterization based on 18SSU rDNA sequencing performed to confirm the taxonomic position of this species and to documents the morphological data. Sequence alignment detects a percent of identity up to 88.0% with other Heteroxynematidae species. Phylogenetic analysis showed that the present recorded is a putative sister taxon to A. tetraptera recorded in a previous study. The SSU rDNA sequence has been deposited in the GenBank under the accession no. MG019400.

Rewaida Abdel-Gaber, Fathy Abdel-Ghaffar, Saleh Al Quraishy, Kareem Morsy, Rehab Saleh, Heinz Mehlhorn

Journal of Nematology, Volume 50 , ISSUE 2, 117–132

Original Paper | 15-March-2016

Characterization and Optimization of Biosynthesis of Bioactive Secondary Metabolites Produced by Streptomyces sp. 8812

®ZYM test were analyzed and genetic analysis made. Phylogenetic analysis of Streptomyces sp. 8812 revealed that its closest relative is Streptomyces capoamus JCM 4734 (98%), whereas sequence analysis for 16S rRNA gene using NCBI BLAST algorithm showed 100% homology between these two strains. Biosynthetic processes, mycelium growth and enzyme inhibitory activities of these two strains were also compared.

Aleksandra Rajnisz, Adam Guśpiel, Magdalena Postek, Joanna Ziemska, Anna Laskowska, Daniel Rabczenko, Jolanta Solecka

Polish Journal of Microbiology, Volume 65 , ISSUE 1, 51–61

Original Paper | 28-December-2016

Characterization of Endolithic Culturable Microbial Communities in Carbonate Rocks from a Typical Karst Canyon in Guizhou (China)

The endolithic environment is a ubiquitous habitat for microorganisms and a critical interface between biology and geology. In this study, a culture-based method and the phylogenetic analysis based on 16S rRNA and internal transcribed spacer (ITS) sequences were used to investigate the diversity of endolithic bacteria and fungi in two main types of carbonate rocks (namely dolomite and limestone) from Nanjiang Canyon in Guizhou karst area, China. The results of bacterial diversity indicated that

Yuan Tang, Jian-Zhong Cheng, Bin Lian

Polish Journal of Microbiology, Volume 65 , ISSUE 4, 413–423

Original Paper | 09-March-2018

Isolation and Characteristics of Biotechnologically Important Antagonistic Thermophilic Bacteria from Rhizosphere of Haloxylon salicornicum

bacterial isolates cladded with their respective groups in the phylogenetic tree. Many (11–15 out of 20) of the isolates were more effective in inhibiting growth of the tested bacterial strains as compared to the positive control (Ampicillin 50 μg/disc). We conclude that bacilli are the predominant form populating rhizosphere of this desert grass. Among the isolated bacteria Brevibacillus borstelensis, Bacillus subtilis and Bacillus licheniformis are the most predominant species.

Muhammad Aslam, Faiz-Ul-Hassan Nasim, Rana Ruhi, Hassan Murad, Samina Ejaz, Muhammad Shafiq Choudhary, Ghulam Mustafa, Muhammad Ashraf, Jameel Rehman

Polish Journal of Microbiology, Volume 67 , ISSUE 1, 49–58

research-article | 27-May-2019

Description of Geocenamus vietnamensis sp. n. (Nematoda: Merliniidae) from Vietnam

. (1999). Primers for D2–D3 of 28S rDNA amplification were D2A (59-ACAAGTACCGTGGGGAAAGTTG-39) and D3B (59-TCGGAAGGAACCAGCTACTA-39) (Subbotin et al., 2006). Primers for ITS rDNA amplification were modified from Vrain et al. (1992): VRAIN 2F (59-CTTTGTACACACCGCCCGTCGCT-39) and VRAIN 2R (59-TTTCACTCGCCGTTACTAAGGGAATC-39). Phylogenetic analyses The BLAST homology search program was used to search for closely related species on GenBank. The sequence data set was aligned with the ClustalW software

Huu Tien Nguyen, Thi Mai Linh Le, Thi Duyen Nguyen, Gracia Liebanas, Thi Anh Duong Nguyen, Quang Phap Trinh

Journal of Nematology, Volume 51 , 1–12

research-article | 30-November-2018

Serendipitous identification of Pratylenchus curvicauda from the grainbelt of Western Australia

none currently includes P. curvicauda (Collins et al., 2015, 2017). One possible reason is the overlapping morphological and morphometric features of root lesion nematodes that often make it difficult to distinguish between species accurately (Castillo and Vovlas, 2007). Hence, molecular approaches and phylogenetic analyses tools have been combined to distinguish species, as together, they offer greater accuracy and reproducibility. These tools are also adaptable for nematode diagnostics, as long

Farhana Begum, John Fosu-Nyarko, Shashi Sharma, Bill Macleod, Sarah Collins, Michael G. K. Jones

Journal of Nematology, Volume 51 , 1–15

review-article | 30-November-2019

Updating the picture of layer 2/3 VIP-expressing interneuron function in the mouse cerebral cortex

embedded in the rise of vertebrates or even slightly (on the scale of evolution) earlier – with the emergence of cephalochordates (Cardoso et al., 2010; Ng et al., 2012; Jékely, 2013). Interestingly, VIP’s pleiotropic effects do not seem to have a simultaneous evolutionary origin. Phylogenetic analysis indicates that VIP and PACAP’s signaling originated in the brain and during subsequent evolution spread alongside the central nervous system and to the periphery (Ng et al., 2012). It is worth noting

Anna Posłuszny

Acta Neurobiologiae Experimentalis, Volume 79 , ISSUE 4, 328–337

Original Paper | 28-June-2017

Molecular Study of Indigenous Bacterial Community Composition on Exposure to Soil Arsenic Concentration Gradient

analysis of 16S rDNA based DGGE fingerprint markedly distributed the soil bacterial populations into low (< 10 ppm) and high (> 10 ppm) arsenic content subgroups. Following analysis of diversity indices shows significant variation in bacterial community structure. MDS (Multi Dimensional Scaling) plot revealed distinction in the distribution of each sample denoting variation in bacterial diversity. Phylogenetic sequence analysis of fragments excised from DGGE gel revealed the presence of &gamma

Semanti Basu, Tanima Paul, Priya Yadav, Abhijit Debnath, Keka Sarkar

Polish Journal of Microbiology, Volume 66 , ISSUE 2, 209–221

research-article | 30-November-2018

Integrative taxonomy of Xiphinema histriae and Xiphinema lapidosum from Spain

D2 to D3 segments, ITS1 and partial CoxI gene sequences, and (iii) to determine the phylogenetic relationships of both species within the X. non-americanum group species. Materials and methods Nematode sampling, extraction, and morphological study Nematodes were surveyed from 2017 to 2018 during the spring season in natural ecosystems and olive growing area in Andalucia, southern Spain (Table 1). Soil samples were collected for nematode analysis with a shovel from four to five cores randomly

Ruihang Cai, Antonio Archidona-Yuste, Carolina Cantalapiedra-Navarrete, Juan E. Palomares-Rius, Jingwu Zheng, Pablo Castillo

Journal of Nematology, Volume 51 , 1–21

research-article | 30-November-2018

New data on known species of Hirschmanniella and Pratylenchus (Rhabditida, Pratylenchidae) from Iran and South Africa

; (ii) to study of morphological variations among different P. hippeastri populations, and (iii) to determine the phylogenetic position of H. anchoryzae from Iran using 28S rDNA and P. hippeastri from South Africa using rDNA and mtDNA genes. Materials and methods Nematode materials In 2015, Hirschmanniella specimens were collected from the rhizosphere of Mentha aquatica in Royan (Mazandaran Province, Iran) and Pratylenchus specimens were collected from rhizosphere soil samples of Cape Willow trees

Ebrahim Shokoohi, Joaquín Abolafia, Phatu William Mashela, Nafiseh Divsalar

Journal of Nematology, Volume 51 , 1–26

Research Article | 22-May-2019

GENETIC DIVERSITY OF BOVINE DIARRHEA AND MUCOSAL DISEASE VIRUS

cultures. The phylogenetic analysis of the 5’UTR and Npro region has revealed at least 21 distinct subtypes of BVDV-1 and 4 subtypes of BVDV-2. Genetic diversity of BVD viruses has serious clinical implications such as immune evasion, increase of virulence, host range alteration and also affects the efficacy of vaccination programmes and diagnostic methods.

Paweł Mirosław, Aleksandra Antos, Mirosław Polak

Postępy Mikrobiologii - Advancements of Microbiology, Volume 56 , ISSUE 4, 389–394

research-article | 30-November-2019

Effect of Heterodera schachtii female age on susceptibility to three fungal hyperparasites in the genus Hyalorbilia

majority of previously described nematophagous Dactylella species (Pramer, 1964). A phylogenetic analysis of DoUCR50, StM, and ARF revealed that they are members of a clade of similar nematophagous fungi (Yang et al., 2012). This rRNA ITS analysis showed that these three fungi belong to an assemblage of organisms, originally called the DO Clade, with global distribution. In addition to confirming the phylogenetic placement of ARF within the DO Clade, Sharma et al. (2017) created a draft genome assembly

J. Smith Becker, J. Borneman, J. O. Becker

Journal of Nematology, Volume 52 , 1–12

No Record Found..
Page Actions