research-article | 17-March-2020
USA where related species may exist.
Molecular and morphological taxonomic identifications were conducted in our lab with the nematodes isolated from the lesions of the BLD leaves collected in Fall, 2017 from Perry, Lake County, Ohio, USA by an Ohio Department of Agriculture nursery inspector from ailing American beech trees Fagus grandifolia (Fall specimens). Their ribosomal DNA (rDNA) loci were amplified by PCR with the one primer set and an enhanced DNA polymerase system, and the resulting 3.5
L.K. Carta,
S. Li
Journal of Nematology, Volume 52 , 1–15
research-article | 03-June-2019
Eukaryotic nuclear ribosomal DNA (rDNA) is arranged in tandem repeat arrays in the genome. Each repeat unit consists of one copy of small subunit (SSU) 18S, internal transcribed spacers (ITS1 and ITS2), 5.8S, and large subunit (LSU) 28S rDNA, and is separated by an external transcribed spacer (EST) and an intergenic spacer (IGS) (Hillis and Dixon, 1991). The copy number of the repeats within most eukaryotic genomes is high, which provide large quantities of template DNA for PCR. In
L. K. Carta,
S. Li
Journal of Nematology, Volume 51 , 1–8
Article | 21-July-2017
northwestern North America were discovered. Nematodes were identified and characterized microscopically and molecularly with 28S ribosomal RNA (rRNA) and 18S rRNA molecular markers. From P. angustifolia, Aphelenchoides saprophilus was inferred to be closest to another population of A. saprophilus among sequenced taxa in the 18S tree. From P. trichocarpa, Laimaphelenchus heidelbergi had a 28S sequence only 1 bp different from that of a Portuguese population, and 1 bp different from the
LYNN K. CARTA,
SHIGUANG LI,
ANDREA M. SKANTAR,
GEORGE NEWCOMBE
Journal of Nematology, Volume 48 , ISSUE 1, 28–33
research-article | 24-April-2020
Milad Rashidifard,
Gerhard Du Preez,
Joaquín Abolafia,
Majid Pedram
Journal of Nematology, Volume 52 , 1–10
Original Paper | 10-December-2018
Abstract
A collection of heterotrophic bacteria consisting of 167 strains was obtained from microbial communities of biofilms formed on solid substrates in the littoral zone of Lake Baikal. Based on the analysis of 16S rRNA gene fragments, the isolates were classified to four phyla: Proteobacteria, Firmicutes, Actinobacteria, and Bacteroidetes. To assess their biotechnological potential, bacteria were screened for the presence of PKS (polyketide synthase) and NRPS (non-ribosomal peptide
ELENA SUKHANOVA,
EKATERINA ZIMENS,
OKSANA KALUZHNAYA,
VALENTINA PARFENOVA,
OLGA BELYKH
Polish Journal of Microbiology, Volume 67 , ISSUE 4, 501–516
Research Article | 03-September-2018
In search for local entomopathogenic nematode (EPN) species as a biological control agent of lepidopterous insect pests of corn, a survey for EPN in the major islands in the Philippines was conducted. Seven EPN populations from 279 soil samples were isolated using Ostrinia furnacalis, the key target insect pest of corn in the country, as bait. Analysis of the ITS1-5.8S-ITS2 ribosomal DNA sequence revealed the presence of Steinernema abbasi, Steinernema minutum, Steinernema tami, and
Barbara L. Caoili,
Romnick A. Latina,
Regina Faye C. Sandoval,
Joey I. Orajay
Journal of Nematology, Volume 50 , ISSUE 2, 99–110
research-article | 30-November-2020
Tam T. T. Vu,
Thi Mai Linh Le,
Thi Duyen Nguyen
Journal of Nematology, Volume 53 , 1–22
research-article | 30-November-2020
Candice Jansen van Rensburg,
Hendrika Fourie,
Samad Ashrafi,
Milad Rashidifard
Journal of Nematology, Volume 53 , 1–10
research-article | 30-November-2020
Parkellus rDNA sequence fragments, as well as ribosomal DNA fragments of Coomansus parvus used in this study as a close reference species, were deposited in GenBank under the following accession numbers: MT799665–MT799669 (18S rDNA) and MT799670–MT799673 (28S rDNA).
Sequence analysis and phylogenetic studies
The newly obtained rDNA sequences were analyzed using the BioEdit program (Hall, 1999: v.7.2.5). The final 18S and 28S rDNA datasets for phylogenetic study included sequences from the three
Tam T.T. VU,
Katarzyna Rybarczyk-Mydłowska,
Andrij Susulovsky,
Magdalena Kubicz,
Łukasz Flis,
Thi Mai Linh Le,
Grażyna Winiszewska
Journal of Nematology, Volume 53 , 1–22
research-article | 13-April-2020
in Estahban (Fars province) during the present study, the morphological and morphometric characters of this population were found to be in accordance with the data presented by Hunt (1993), Vovlas and Larizza (1996) and Kolaei et al. (2016). Therefore, the present study aimed to characterize this recently recovered population for its molecular identity by sequencing the D2-D3 expansion fragments of the large subunit of the ribosomal DNA gene, as the first molecular analysis of the Iranian
Hadi Karimipour Fard,
Hamid Zare
Journal of Nematology, Volume 52 , 1–3
Research Article | 03-December-2018
L. K. Carta,
W. K. Thomas,
V. B. Meyer-Rochow
Journal of Nematology, Volume 50 , ISSUE 4, 479–486
research-article | 30-November-2019
Natsumi Kanzaki,
Minami Ozawa,
Yuko Ota,
Yousuke Degawa
Journal of Nematology, Volume 52 , 1–10
research-article | 30-November-2020
county, Colorado, USA. A, B: J2 anterior ends; C, D: J2 tails; E: J2 lateral field; F: Cyst posterior (ventral view); G: Cyst cone mount.
Representative J2 from two CO isolates and three MN isolates were used for molecular confirmation of the species, using two ribosomal genes (internal transcribed spacer, ITS 1 and 2 and large ribosomal subunit, 28S), one nuclear gene (partial heat shock protein 90, Hsp90), and one mitochondrial gene (partial cytochrome oxidase I, COI). Markers were amplified
Andrea M. Skantar,
Zafar A. Handoo,
Mihail R. Kantor,
Saad L. Hafez,
Maria N. Hult,
Kathryn Kromroy,
Kimberly Sigurdson,
Michelle Grabowski
Journal of Nematology, Volume 53 , 1–7
research-article | 30-November-2018
1000X magnification with compound microscope and SEM.
Molecular analysis of the ribosomal RNA and mitochondrial gene sequences of the extracted nematodes confirmed their species as P. vulnus (Table 1). The rDNA LSU region (D2A/D3B: ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (Nunn, 1992), rDNA ITS region (TW81/AB28: GTTTCCGTAGGTGAACCTGC/ATATGCTTAAGTTCAGCGGGT) (Amiri et al., 2002; Subbotin et al., 2001), rDNA SSU region (SSU18A/SSU26R: AAAGATTAAGCCATGCATG/CATTCTTGGCAAATGCTTTCG) (Eyualem and
Yu-po Lin,
Wan-chun Lee,
Pei-che Chung,
Jiue-in Yang
Journal of Nematology, Volume 51 , 1–5
Original Research | 11-December-2017
and diagnostic features of Pseudacrobeles species and molecular sequence data from the D2-D3 regions of the 28S ribosomal DNA (rDNA) and ITS1-5.8S-ITS2 region of rDNA from the new species, which can be used as molecular barcode sequences.
Jiyeon Kim,
Taeho Kim,
Joong-Ki Park
Journal of Nematology, Volume 49 , ISSUE 2, 162–167
research-article | 30-November-2018
of Aphelenchoides stammeri are very similar to the original description of the species by Körner (1954). Confirmation of the morphological description was made by H. Braasch (pers. Comm. with H. Braasch).
Molecular characterization
The length of sequenced 18S rRNA was 641 bp and matched with A. stammeri gene for 18S ribosomal RNA, partial sequence (AB368535.1) (99% identify, e-value 0.0 and 0% gaps), and the length of sequenced 28S rRNA was 618 and matched with A. stammeri partial 28S rRNA gene
Mehmet Dayi,
Ece B. Kasapoğlu Uludamar,
Süleyman Akbulut,
İ. Halil Elekcioğlu
journal of nematology, Volume 51 , 1–6
research-article | 30-November-2019
field differentiation, tail length, and hyaline tail length in J2 (Subbotin et al., 2010). Since the last two decades, employing molecular data such as ITS and 28S of ribosomal DNA and COI gene of mitochondrial DNA to characterize Heterodera species has been a common practice, including DNA barcoding, phylogeny, and even phylogeography (Ferris et al., 1999; Toumi et al., 2013a; Subbotin et al., 2017, 2018).
Herein, we characterize Heterodera dunensis n. sp. discovered in a recent exploratory survey
Phougeishangbam Rolish Singh,
Gerrit Karssen,
Marjolein Couvreur,
Wim Bert
Journal of Nematology, Volume 52 , 1–14
Research Article | 03-December-2018
The 18S small subunit (SSU) ribosomal DNA sequence is one of the most useful molecular loci for identification and phylogeny reconstruction of agriculturally important nematodes. Various pairs of universal primers have been developed in the past to amplify short and long nematode sequences. However, certain nematode taxa were not readily amplified and/or sequenced with the existing primer tools. Frequently, the center region of a roughly 1,000 nucleotide segment would be lost. Therefore new
L. K. Carta,
S. Li
Journal of Nematology, Volume 50 , ISSUE 4, 533–542
Article | 21-July-2017
SERGIO ALVAREZ-ORTEGA,
THI ANH DUONG NGUYEN,
JOAQUI´N ABOLAFIA,
MICHAEL BONKOWSKI,
REYES PEN˜A-SANTIAGO
Journal of Nematology, Volume 48 , ISSUE 2, 95–103
research-article | 30-November-2020
. yeatesi Zhao, 2009
New Zealand
T. ymyensis Tahseen & Nusrat, 2010
China
T. zhejiangensis Pham et al., 2013
China
Starting with the work by Zhao (2009), half of the described species have been characterized molecularly by partial sequences of either one or two of the ribosomal DNA genes (18 S and/or 28 S rDNA). The rDNA-based phylogenetic analyses revealed the well-supported monophyletic status of Tripylina (Asghari et al., 2012; Cid del Prado-Vera et al., 2012, 2016; Xu et al., 2013
Marek Renčo,
Katarzyna Rybarczyk-Mydłowska,
Łukasz Flis,
Magdalena Kubicz,
Grażyna Winiszewska
Journal of Nematology, Volume 53 , 1–10
research-article | 25-May-2020
Fariba Heydari,
Majid Pedram
Journal of Nematology, Volume 52 , 1–12
research-article | 30-November-2018
Thi Duyen Nguyen,
Huu Tien Nguyen,
Thi Mai Linh Le,
Neriza Nobleza,
Quang Phap Trinh
journal of nematology, Volume 51 , 1–5
research-article | 30-November-2019
corms and roots of banana where they were likely to cause damage to the crop (Sikora et al., 2018). Phylogenetic analysis of Hoplolaimus spp. using D2–D3 expansion of 28 S and internal transcribed spacer (ITS1) ribosomal DNA sequences resolved the phylogeny of the genus and were useful in molecular identification of Hoplolaimus spp. (Bae et al., 2008). In addition, the PCR-RFLP method was applied by different researchers to evaluate the genetic diversity of Hoplolaimus spp. (Robbins et al., 2009
Mariette Marais,
Esther van den Berg,
Hendrika Fourie,
Milad Rashidifard
Journal of Nematology, Volume 52 , 1–12
research-article | 17-March-2020
by Majorbio, Shanghai, China) were used in the PCR analyses to amplify the near full length 18 S, full length ITS region and D2-D3 expansion segments of the 28 S ribosomal RNA genes (rDNA). The near full length 18 S region was amplified as two partially overlapping fragments; for the first fragment, 988 F (5-CTC AAA GAT TAA GCC ATG C-3) and 1912R (5-TTT ACG GTC AGA ACT AGG G-3) were used and for the second fragment 1813F (5-CTG CGT GAG AGG TGA AAT-3) and 2646 R (5-GCT ACC TTG TTA CGA CTT TT-3
Jianfeng Gu,
Munawar Maria,
Yiwu Fang,
Lele Liu,
Yong Bian,
Xianfeng Chen
Journal of Nematology, Volume 52 , 1–1
research-article | 30-November-2019
% Triton x–100, 4.5% Tween–20, 0.09% Proteinase K). The tubes were incubated at −80°C (15 min), 65°C (1 h), and 95°C (15 min), centrifuged to 16,000 g (1 min) and stored at −20°C. Amplification of D2 to D3 expansion segment of the large subunit – LSU of ribosomal DNA (28S) was done using forward primer D2A (5′–ACAAGTACCGTGAGGGAAAGTTG–3′) and reverse D3B (5′–TCCTCGGAAGGAACCAGCTACTA–3′) (De Ley et al., 1999). The PCR conditions were initial denaturation during 2 min at 94°C followed by 40 cycles of 45 s
Donald Riascos-Ortiz,
Ana Teresa Mosquera-Espinosa,
Francia Varón De Agudelo,
Claudio Marcelo Gonçalves de Oliveira,
Jaime Eduardo Muñoz-Florez
Journal of Nematology, Volume 52 , 1–19
research-article | 15-August-2017
Maria Munawar,
Thomas O. Powers,
Zhongling Tian,
Timothy Harris,
Rebecca Higgins,
Jingwu Zheng
Journal of Nematology, Volume 50 , ISSUE 2, 183–206
Article | 21-July-2017
and 18S ribosomal DNA and shown to belong to the family Panagrolaimidae (Rhabditida), within a clade of Panagrellus. While most nematodes in the insect were juveniles, a single male adult was partially characterized by light microscopy. Morphometrics showed similarities to a species described from Germany. Excluding the entomopathogenic nematodes (EPN), only five other genera of entomophilic or saprophytic rhabditid nematodes are associated with this weevil. This is the first
MANUELA CAMEROTA,
GIUSEPPE MAZZA,
LYNN K. CARTA,
FRANCESCO PAOLI,
GIULIA TORRINI,
CLAUDIA BENVENUTI,
BEATRICE CARLETTI,
VALERIA FRANCARDI,
PIO FEDERICO ROVERSI
Journal of Nematology, Volume 48 , ISSUE 1, 1–6
Research Article | 03-December-2018
. Microscopic observation of females and males demonstrated the occurrence of Pratylenchusd vulnus on apple trees. The ribosomal DNA D2-D3 expansion segments of the 28S rRNA and of the Pratylenchus populations were PCR amplified and sequenced. The sequences were compared with those of Pratylenchus species in the GenBank database with high similarity (99%). This comparison reconfirmed the morphological identifications. Phylogenetic studies placed those populations with P. vulnus. This is the first report of
Noura Chihani-Hammas,
Lobna Hajji-Hedfi,
Hajer Regaieg,
Asma Larayedh,
Ahmed Badiss,
Yu Qing,
Horrigue-Raouani Najet
Journal of Nematology, Volume 50 , ISSUE 4, 579–586
research-article | 30-November-2019
) buffer (10 mM Tris-Cl, 0.5 mM EDTA, pH 9.0, Qiagen) on a clean slide, and squashed using a clean slide cover with the aid of a pipette tip. The suspension was collected by adding 20 μl of TE buffer after gently removing the slide cover and leaving the solution on the slide (Pedram, 2017). The DNA sample was stored at −20°C until used as the polymerase chain reaction (PCR) template. The near-full-length sequence of the small subunit ribosomal DNA (SSU rDNA) was amplified using the forward primer 18S4
Farahnaz Jahanshahi Afshar
Journal of Nematology, Volume 52 , 1–7
original-paper | 27-December-2020
%, and 22.21%, respectively.
The viral genome of Ahast encodes three ORFs, including ORF1a, ORF1b, and ORF2. There is a 8 nt overlap between ORF1b and ORF2. The conserve Kozak sequences of RNNAUGG were identified near the start codon of both three ORFs (GCTATGG for ORF1a, AAAATGT for ORF1b, and CTAATGG for ORF2). A translational ribosomal frameshifting signal existed in the 3' end of Ahast ORF1a Fig. 1a. The Conserved Domains analysis (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) indicated
XU CHEN,
YUMIN HE,
WEINA LI,
ULLAH KALIM,
YUQING XIAO,
JIE YANG,
XIAOCHUN WANG,
SHIXING YANG,
WEN ZHANG
Polish Journal of Microbiology, Volume 69 , ISSUE 4, 471–478
research-article | 30-November-2020
., 2021; Mayer et al., 2007), the species diversity of the genus is still far from saturated (Kanzaki et al., 2021; Rödelsperger et al., 2018), and further isolation of various species is necessary to improve the model system.This study describes a species of Pristionchus recovered from fruiting bodies (mushrooms) of the wood-decaying fungus Trametes orientalis (Yasuda) based on its typological characters and ribosomal RNA sequences, which were used as species-specific molecular barcodes.
Materials
Natsumi Kanzaki,
Keiko Hamaguchi
Journal of Nematology, Volume 53 , 1–13
Article | 21-July-2017
-pharynx (D% = 46). Hyaline layer occupies approximately half of tail length. Male spicules slightly to moderately curved, with a sharp tip and golden brown in color. The first generation of males lacking a mucron on the tail tip while the second generation males with a short filamentous mucron. Genital papillae with 11 pairs and one unpaired preanal papilla. The new species is further characterized by sequences of the internal transcribed spacer (ITS) and partial 28S regions (D2-D3) of the ribosomal
HARUN CIMEN,
VLADIMI´R PU°zA,
JIRI NERMUT,
JUSTIN HATTING,
TSHIMA RAMAKUWELA,
SELCUK HAZIR
Journal of Nematology, Volume 48 , ISSUE 3, 148–158
research-article | 30-November-2019
ribosomal RNA gene (COII-16S) was amplified using the forward C2F3 (5´-GGT CAA TGT TCA GAA ATT TGT GG-3´) and reverse 1108 (5´-TAC CTT TGA CCA ATC ACG CT-3´) primers (Powers and Sanders, 1993). The following primers were used for the amplification of the ITS1 region, including partial sequences of the 18S and 5.8S rRNA genes: 5´-TTG ATT ACG TCC CTG CCC TTT-3´ (Vrain et al., 1992) and 5´-ACG AGC CGA GTG ATC CAC CG-3´ (Cherry et al., 1997). The obtained sequences for M. kikuyensis were deposited in
J. D. Eisenback,
P. Vieira
Journal of Nematology, Volume 52 , 1–13
research-article | 30-November-2020
Mihail R. Kantor,
Zafar A. Handoo,
Sergei A. Subbotin,
Gary R. Bauchan,
Joseph D. Mowery
Journal of Nematology, Volume 53 , 1–10
research-article | 18-March-2020
Jianfeng Gu,
Munawar Maria,
Lele Liu,
Majid Pedram
Journal of Nematology, Volume 52 , 1–11
research-article | 22-February-2021
accepted and its widespread use has also recently been facilitated by a web-based key that draws its basis from cluster analysis (Nguyen et al., 2019). In combination with the morphological features, molecular information such as ITS, 18S, and 28S of ribosomal DNA and COI of mitochondrial DNA have been used for their identification.
In the current paper, we characterize a newly discovered Rotylenchus wimbii n. sp. found associated with finger millet, Eleusine coracana (L.) Gaertn. (Planta: Poaceae) in
Phougeishangbam Rolish Singh,
Gerrit Karssen,
Kelvin Gitau,
Cecilia Wanjau,
Marjolein Couvreur,
Njira Njira Pili,
Godelieve Gheysen,
Wim Bert
Journal of Nematology, Volume 53 , 1–14
research-article | 30-November-2020
mM Tris pH 8.0, 15 mM MgCl2, 0.5% Triton × 100, 4.5% Tween 20, and 0.09% Proteinase K). Subsequently, the tubes were incubated at ‒80°C for 15 min, 65 °C for 1 h, and 95°C for 15 min, centrifuged at 16,000 × g for 1 min, and stored at ‒20°C. The polymerase chain reaction (PCR) amplification of the expansion segment D2-D3 of the large subunit of ribosomal DNA (28S) was performed with the primers D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) forward and D3B (5′-TCCTCGGAAGGAACCAGCTACTA-3′) reverse, according
Oscar Velandia,
Yuri Mestizo,
Héctor Camilo Medina,
Donald Riascos-Ortiz,
Francia Varón De Agudelo,
Greicy Andrea Sarria
Journal of Nematology, Volume 53 , 1–14
Article | 21-July-2017
to the Belonolaimus longicaudatus species complex. Molecular analyses based on the 28S gene and ITS1-5.8S-ITS2 regions of the ribosomal RNA (rRNA) identified four major clades within Belonolaimus; however, none of the species including B. longicaudatus, B. gracilis, and B. euthychilus were supported as monophyletic; yet monophyly is argued to be a basic requirement of species status. Sequence divergence among different Belonolaimus populations and species varied according to the rRNA dataset (i.e
MANUEL MUNDO-OCAMPO,
J. G. BALDWIN,
T. J. PEREIRA,
J. R. CAMACHO-BAEZ,
A. D. ARMENTA-BOJORQUEZ,
M. CAMACHO-HARO,
J. O. BECKER
Journal of Nematology, Volume 49 , ISSUE 1, 103–113
research-article | 17-March-2020
Doreen M. Mgonja,
Gladness E. Temu,
Joseph C. Ndunguru,
Magreth F. Mziray,
Sylvester L. Lyantagaye,
Nessie D. Luambano
Journal of Nematology, Volume 52 , 1–8
research-article | 30-March-2020
, 0.2 mM dNTPs, 1U Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA), 3 µl nematode DNA extract, and supplied enzyme reaction buffer in a total volume of 25 µl. Cycling included one step of 95°C for 2 min, followed by 35 cycles of 95°C for 30 sec, 55°C for 30 sec, and 72°C for 90 sec, finished with one cycle at 72°C for 5 min (Skantar et al., 2007).
28S: Amplification of the 28S large ribosomal subunit (LSU) D2-D3 expansion segment included the primers D2A [5′-ACAAGTACCGTGAGGGAAAGTT-3′] and D3B
Andrea M. Skantar,
Zafar A. Handoo,
Mihail R. Kantor,
Lynn K. Carta,
Jamal Faghihi,
Virginia Ferris
Journal of Nematology, Volume 52 , 1–8
research-article | 30-November-2019
oxidase I (COI) was amplified with JB3 [5’-TTTTTTGGGCATCCTGAGGTTTAT-3’] and JB5 [5’-AGCACCTAAACTTAA AACATAATGAAAATG-3’] (Derycke et al., 2005) as described in Ozbayrak et al. (2019). PCR amplicons of 403 bp were cleaned and sequenced directly with the same primers. The 28 S large ribosomal subunit D2-D3 expansion segment was obtained via amplification with the primers D2A [5’-ACAAGTACCGTGAGGGAAAGTTG-3’] and D3B [5’-TCGGAAGGAACCAGCTACTA-3’] (De Ley et al., 2005; Ye et al., 2007), producing sequences of
Zafar A. Handoo,
Andrea M. Skantar,
Mihail R. Kantor,
Saad L. Hafez,
Maria N. Hult
Journal of Nematology, Volume 52 , 1–5
research-article | 26-March-2021
these worms between genera and within the family Anisakidae (Nadler et al., 2005, 2007). On the contrary, high copy and short transcribed rDNA spacers ITS1, ITS2 (Campbell et al., 1994; Hoste et al., 1995; Samson-Himmelstjerna et al., 1997) and the region spanning the ITS1, the 5.8S gene, and the ITS2 of the ribosomal DNA are suitable genetic markers for the identification of nematodes, in particular anisakid species regardless of their stage of development (D’Amelio et al., 2000; Jabbar et al
Alina E. Safonova,
Anastasia N. Voronova,
Konstantin S. Vainutis
Journal of Nematology, Volume 53 , 1–10
research-article | 06-June-2019
process as well as to delineate more phylogenetically distant species, which share the same morphology (cryptic species), the support of a molecular approach is needed.
To date, only about 20% of Helicotylenchus species has been molecularly characterized using mostly ribosomal DNA fragments (18S, ITS, 28S rDNA; GenBank resources). Mitochondrial cytochrome c oxidase subunit I (mtCOI) sequences were reported for one species, the recently described H. oleae (Palomares-Rius et al., 2018), and a cytochrome
K. Rybarczyk-Mydłowska,
E. Dmowska,
K. Kowalewska
Journal of Nematology, Volume 51 , 1–17
research-article | 30-November-2019
Fariba Heydari,
Joaquín Abolafia,
Majid Pedram
Journal of Nematology, Volume 52 , 1–13
research-article | 30-November-2019
, covered vulva by a protuding anterior vulvar lip, presence of a long post-uterine sac, a narrow and elongated tail with a clindroid and rounded terminus (Opperman, 1995).
Currently, DNA sequences of segment D2-D3, Internal Transcribed Spacer-(ITS) of ribosomal RNA and Cytochrome oxidase subunit I-COI of mitochondrial DNA have been obtained for B. cocophilus in coconut palm and deposited in public molecular databases, which are used as a reference for the identification of the nematode (Ye et al., 2007
Greicy Andrea Sarria,
Donald Riascos-Ortiz,
Hector Camilo Medina,
Yuri Mestizo,
Gerardo Lizarazo,
Francia Varón De Agudelo
Journal of Nematology, Volume 52 , 1–12
original-paper | 28-March-2019
, the API 50CHL (Biomerieux, Marcy l’etoile, France) kit, which tests for 49 carbohydrates and esculin. Other systems designed for Gram-positive or Gram-negative bacteria have been applied to LAB identification, such as the Biolog system, which includes the fermentation of 96 carbohydrates (Moraes et al. 2013). On the other hand, the development of molecular techniques has allowed more accurate identification of LAB. The wide method used for this purpose is based on ribosomal gene sequencing or
JOHANNA SÁNCHEZ,
CARLOS VEGAS,
AMPARO IRIS ZAVALETA,
BRAULIO ESTEVE-ZARZOSO
Polish Journal of Microbiology, Volume 68 , ISSUE 1, 127–137
original-paper | 17-September-2021
SUKYUNG KIM,
HOONHEE SEO,
MD ABDUR RAHIM,
HANIEH TAJDOZIAN,
YUN-SOOK KIM,
HO-YEON SONG
Polish Journal of Microbiology, Volume 70 , ISSUE 3, 345–357
research-article | 30-November-2019
, 10 females and 10 males were observed under a microscope (Nikon eclipse e200), and morphometric measurements were performed (Table 1). The maximum and minimum ranges of the body length were obtained: L, body width: W, spicules, distance from the part before the vulva, and length of eggs. The average values were calculated.
Molecular identification
For molecular identification, an 832 bp fragment of the D2D3 region of the 28s ribosomal gene was amplified by PCR. The sequence of the MC5 2014
Iveth del Rocio Castro-Ortega,
Juan Manuel Caspeta-Mandujano,
Ramón Suárez-Rodríguez,
Guadalupe Peña-Chora,
José Augusto Ramírez-Trujillo,
Karina Cruz-Pérez,
Iván Arenas Sosa,
Víctor Manuel Hernández–Velázquez
Journal of Nematology, Volume 52 , 1–8
original-paper | 19-March-2021
ribosomal RNA gene. We used the V4 region-specific primers with a locus-specific overhang sequence: 515F-5’ – TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-GTGCCAGCMGCCGCGGTAA and 806R – 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-GGACTACHVGGGTWTCTAAT (overhang sequence-locus specific-sequence). We attached indexes and Illumina sequencing adapters through index PCR using a Nextera XT Index kit v2 (Illumina, USA). We used Agencourt AMPure XP (Beckman Coulter, USA) beads after every PCR step to purify the PCR products and
MD ABDUR RAHIM,
HOONHEE SEO,
SUKYUNG KIM,
YOON KYOUNG JEONG,
HANIEH TAJDOZIAN,
MIJUNG KIM,
SAEBIM LEE,
HO-YEON SONG
Polish Journal of Microbiology, Volume 70 , ISSUE 1, 117–130
research-article | 30-November-2020
. The specimens were then transferred to two individual Eppendorf tubes containing 15 µl ddH2O and their respective DNA was extracted using the chelex-100 protocol of Rashidifard et al. (2019). The DNA samples were stored at –20°C until used for amplification. The partial sequences of the large subunit ribosomal DNA (LSU rDNA D2-D3) were amplified using forward primer D2A (5′–ACAAGTACCGTGAGGGAAAGT–3′) and reverse primer D3B (5′–TCGGAAGGAACCAGCTACTA–3′) (Nunn, 1992). The polymerase chain reaction (PCR
Farahnaz Jahanshahi Afshar,
Milad Rashidifard,
Joaquín Abolafia,
Miloslav Zouhar,
Hendrika Fourie,
Majid Pedram
Journal Of Nematology, Volume 53 , 1–14
Research Article | 17-October-2018
morphometric data ranges. The morphological features and morphometrics of the second studied species, A. helicus, agreed well with the data given for the type population. However, detailed study of fresh females revealed it has three drop-shaped stylet knobs and long PUS, making it typologically similar to the genus Robustodorus, meriting its taxonomic revision, i.e., transferring to it. In molecular phylogenetic analyses using partial small and large subunit ribosomal RNA gene (SSU and LSU rDNA) sequences
Farzad Aliramaji,
Ebrahim Pourjam,
Sergio Álvarez-Ortega,
Farahnaz Jahanshahi Afshar,
Majid Pedram
Journal of Nematology, Volume 50 , ISSUE 3, 437–452
research-article | 30-November-2020
ribosomal markers (e.g. Panahandeh et al., 2018; Qing and Bert, 2018), the two currently resolved phylogenies using both SSU and LSU ribosomal markers, show the genus Filenchus is polyphyletic. These results are updates to the study of Atighi et al. (2013), showing Filenchus is polyphyletic using SSU, but monophyletic using LSU data.
Currently there are six species under the genus Discotylenchus (Geraert, 2008) all of which being established based upon morphological criteria. The SEM data are however
Parnaz Mortazavi,
Fariba Heydari,
Joaquín Abolafia,
Pablo Castillo,
Majid Pedram
Journal of Nematology, Volume 53 , 1–14
research-article | 30-November-2020
C.N. Hesse,
I. Moreno,
O. Acevedo Pardo,
H. Pacheco Fuentes,
E. Grenier,
L. M. Dandurand,
I. A. Zasada
Journal of Nematology, Volume 53 , 1–9
research-article | 01-April-2021
Reihaneh Gholami Ghavamabad,
Ali Asghar Talebi,
Mohammad Mehrabadi,
Mohammad Ebrahim Farashiani,
Majid Pedram
Journal of Nematology, Volume 53 , 1–16
research-article | 30-November-2020
Mohammad Amiri Bonab,
Joaquín Abolafia,
Majid Pedram
Journal of Nematology, Volume 53 , 1–14
Research Article | 26-September-2018
consistent with those of C. estonica, for which the elongated cyst and short hyaline in J2 are characteristic for the species. Ribosomal DNA of the ITS, 18S, and D2/D3 of 28S regions were PCR amplified from cysts and J2s using primers 18S (5′-TTGATTACGTCCCTGCCCTTT-3′) and 26S (5′-TTTCACTCGCCGTTACTAAGG-3′) (Vrain et al., 1992), D2A (5′-ACAAGTACCGTGAGGGAAAGT-3′) (Nunn, 1992) and D3B (5′-GACCCGTCTTGAAACACGGA-3′) (De Ley et al., 1999), and sequenced. The sequences of the ITS and D2/D3 regions of 1,480 and
QING YU,
FENGCHENG SUN
Journal of Nematology, Volume 49 , ISSUE 4, 403–403
Article | 01-July-2019
well as from ATP by the RelA and SpoT enzymes, in response to a deficiency in nutritional substances. As a result of these reactions, AMP is also produced. Phosphate groups marked in grey are present only in the case of GTP and pppGpp.
Alarmones influence the metabolism of a bacterial cell, i.a., by lowering the transcription of genes encoding rRNA, tRNA and ribosomal proteins and increasing the expression of those encoding proteins involved in the synthesis of amino acids and the response to
Julia Berdychowska,
Justyna Boniecka,
Grażyna B. Dąbrowska
Postępy Mikrobiologii - Advancements of Microbiology, Volume 58 , ISSUE 2, 127–142
Article | 24-July-2017
National collection of Insects, Arachnids, and Nematodes (Accession no. 14851 to 14853 for the second stage juveniles and 14854–14855 for the cyst cones). For molecular analysis,DNA was extracted from individual juvenile (n = 4) from different cysts. A 1,151-bp fragment of ribosomal DNA containing ITS1-5.8SITS2 region was amplified and sequenced using primers 18S (5'-TTGATTACGTCCCTGCCCTTT-3') and 26S (5'- TTTCACTCGCCGTTACTAAGG-3') (Vrain et al., 1992). The sequence was
FENGCHENG SUN,
NEIL HENRY,
QING YU
Journal of Nematology, Volume 49 , ISSUE 2, 131–132
research-article | 26-April-2019
Abolfazl Hajihassani,
Weimin Ye,
Brooke B. Hampton
Journal of Nematology, Volume 51 , 1–3