Article | 24-July-2017
of small subunit (SSU) and large subunit (LSU) rDNA D2/D3 fragments, the new species formed a clade with two currently available GenBank-derived, unspecified isolates/sequences in SSU and three other isolates/sequences in LSU trees, respectively.
MAJID PEDRAM
Journal of Nematology, Volume 49 , ISSUE 2, 223–230
research-article | 30-November-2019
) buffer (10 mM Tris-Cl, 0.5 mM EDTA, pH 9.0, Qiagen) on a clean slide, and squashed using a clean slide cover with the aid of a pipette tip. The suspension was collected by adding 20 μl of TE buffer after gently removing the slide cover and leaving the solution on the slide (Pedram, 2017). The DNA sample was stored at −20°C until used as the polymerase chain reaction (PCR) template. The near-full-length sequence of the small subunit ribosomal DNA (SSU rDNA) was amplified using the forward primer 18S4
Farahnaz Jahanshahi Afshar
Journal of Nematology, Volume 52 , 1–7
Article | 21-July-2017
Shahina, category of Aphelenchoides species. Phylogenetic analysis based on small subunit (SSU) and partial large subunit (LSU) sequences of rRNA supported themorphological results.
MEHRAB ESMAEILI,
RAMIN HEYDARI,
MOZHGAN ZIAIE,
JIANFENG GU
Journal of Nematology, Volume 48 , ISSUE 1, 34–42
research-article | 30-November-2020
in 15 µl TE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0, Qiagen) (four DNA samples were prepared for each species) after their examination on temporary slides. DNA samples were stored at ‒20°C until used as PCR templates. Partial sequence of the SSU rDNA gene was amplified using primers 988F (5′-CTCAAAGATTAAGCCATGC-3′), 1912R (5′-TTTACGGTCAGAACTAGGG-3′), 1813F (5′-CTGCGTGAGAGGTGAAAT-3′) and 2646R (5′-GCTACCTTGTTACGACTTTT-3′) with resulting PCR products ranging from 890 to 930 and 970 to 1,017 bp
Parnaz Mortazavi,
Fariba Heydari,
Joaquín Abolafia,
Pablo Castillo,
Majid Pedram
Journal of Nematology, Volume 53 , 1–14
research-article | 30-November-2019
species of Deladenus was recovered from a deadwood sample of a dead forest tree collected from the forests of Golestan province, northern Iran. Thus, the present paper aims to describe the newly recovered species and resolve its phylogenetic relationships with other relevant species and genera using three SSU, LSU rDNA, and COI mtDNA markers.
Materials and methods
Sampling, nematode extraction, mounting, and drawing
Specimens of Deladenus brevis n. sp. were obtained from the bark and rotten wood
Fariba Heydari,
Joaquín Abolafia,
Majid Pedram
Journal of Nematology, Volume 52 , 1–13
Research Article | 03-September-2018
molecular analysis of many D. weischeri specimens from Canada is presented. Individuals from 41C. arvense or yellow pea grain samples with seeds of C. arvense from the Prairie Provinces were sequenced for the internal transcribed spacer (ITS rDNA), large subunit (LSU) D2D3 28S rDNA, partial segment of small subunit (SSU) 18S rDNA, and the heat shock protein Hsp90 gene. The analysis also included D. weischeri individuals from C. arvense from Russia and garlic with D. dipsaci from the Provinces of Ontario
Mehrdad Madani,
Mario Tenuta
Journal of Nematology, Volume 50 , ISSUE 2, 163–182
research-article | 24-April-2020
, 20 km north of the town Lichtenburg (North-West Province, South Africa). In-depth investigations revealed that it belongs to an unknown species, being described herein as C. driekieae n. sp. Therefore, the present study aims to characterize this species using both traditional and molecular techniques and discuss its phylogenetic affinities using SSU and LSU markers.
Materials and methods
Nematode extraction and morphological studies
Nematodes were extracted from the soil using the modified
Milad Rashidifard,
Gerhard Du Preez,
Joaquín Abolafia,
Majid Pedram
Journal of Nematology, Volume 52 , 1–10
research-article | 18-March-2020
(synthesized by Majorbio, Shanghai, China) were used in the PCR analyses to amplify the near full-length SSU and D2-D3 expansion segments of LSU rDNA. The SSU region was amplified as two partially overlapping fragments; for the first fragment, the forward 988F (5′-CTC AAA GAT TAA GCC ATG C-3′) and reverse 1912R (5′-TTT ACG GTC AGA ACT AGG G-3′) primers were used and for the second part, the forward 1813F (5′-CTG CGT GAG AGG TGA AAT-3′) and reverse 2646R (5′-GCT ACC TTG TTA CGA CTT TT-3′) primers were used
Jianfeng Gu,
Munawar Maria,
Lele Liu,
Majid Pedram
Journal of Nematology, Volume 52 , 1–11
research-article | 30-November-2018
1000X magnification with compound microscope and SEM.
Molecular analysis of the ribosomal RNA and mitochondrial gene sequences of the extracted nematodes confirmed their species as P. vulnus (Table 1). The rDNA LSU region (D2A/D3B: ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (Nunn, 1992), rDNA ITS region (TW81/AB28: GTTTCCGTAGGTGAACCTGC/ATATGCTTAAGTTCAGCGGGT) (Amiri et al., 2002; Subbotin et al., 2001), rDNA SSU region (SSU18A/SSU26R: AAAGATTAAGCCATGCATG/CATTCTTGGCAAATGCTTTCG) (Eyualem and
Yu-po Lin,
Wan-chun Lee,
Pei-che Chung,
Jiue-in Yang
Journal of Nematology, Volume 51 , 1–5
Article | 02-November-2017
Kuo-Feng Ssu,
Wei-Tong Wang,
Feng-Kuang Wu,
Tzu-Ting Wu
International Journal on Smart Sensing and Intelligent Systems, Volume 2 , ISSUE 1, 75–93
Research Article | 17-October-2018
morphometric data ranges. The morphological features and morphometrics of the second studied species, A. helicus, agreed well with the data given for the type population. However, detailed study of fresh females revealed it has three drop-shaped stylet knobs and long PUS, making it typologically similar to the genus Robustodorus, meriting its taxonomic revision, i.e., transferring to it. In molecular phylogenetic analyses using partial small and large subunit ribosomal RNA gene (SSU and LSU rDNA) sequences
Farzad Aliramaji,
Ebrahim Pourjam,
Sergio Álvarez-Ortega,
Farahnaz Jahanshahi Afshar,
Majid Pedram
Journal of Nematology, Volume 50 , ISSUE 3, 437–452
Research Article | 03-December-2018
The 18S small subunit (SSU) ribosomal DNA sequence is one of the most useful molecular loci for identification and phylogeny reconstruction of agriculturally important nematodes. Various pairs of universal primers have been developed in the past to amplify short and long nematode sequences. However, certain nematode taxa were not readily amplified and/or sequenced with the existing primer tools. Frequently, the center region of a roughly 1,000 nucleotide segment would be lost. Therefore new
L. K. Carta,
S. Li
Journal of Nematology, Volume 50 , ISSUE 4, 533–542
research-article | 25-May-2020
specimen of the recovered species was picked out, examined on a temporary slide and transferred to a small drop of TE buffer (10 mMTris-Cl, 0.5 mM EDTA, pH 9.0; Qiagen) on a clean slide and crushed using a cover slip. The suspension was collected by adding 20 μl TE buffer. The DNA sample was stored at −20°C until used as PCR template (two separate females were used for this purpose, and two DNA samples were prepared). The SSU rDNA was amplified using the forward primer F22 (5´-TCCAAGGAAGGCAGCAGGC-3
Fariba Heydari,
Majid Pedram
Journal of Nematology, Volume 52 , 1–12
research-article | 30-November-2020
Hosseinvand et al. (2020) followed the framework used by Geraert (2008), stating that the followed taxonomic frame is supported by their resolved SSU phylogeny (also see Discussion section).
During present study, a didelphic tylenchid population was recovered from the soil samples obtained from the Urmia Lake islands. By its typological similarities, and having a Tylenchidae-type cloacal bursa in male, i.e. lacking a bursa enveloping the tail or a trilobed bursa, common in dolichodoirds sensu Geraert
Mohammad Amiri Bonab,
Joaquín Abolafia,
Majid Pedram
Journal of Nematology, Volume 53 , 1–14
research-article | 30-November-2020
the partial 18 S and 28 S D2-D3 region of rDNA. Primers for the D2-D3 domain of 28 S rDNA were D2A (forward: 5’–ACA AGT ACC GTG AGG GAA AGT TG–3’) and D3B (reverse: 5’–TCG GAA GGA ACC AGC TAC TA–3’) (De Ley et al., 1999). Primers for amplification of partial SSU rDNA were forward primer 1096 F (5’–GGT AAT TCT GGA GCT AAT AC–3’) and reverse primer 1912R (5’–TTT ACG GTC AGA ACT AGG G–3’) (Holterman et al., 2006). The thermal cycling program was as follows: denaturation at 95°C for 2 min, followed by
Behrouz Golhasan,
Esmaeil Miraeiz,
Zahra Tanha maafi,
Ramin Heydari
Journal of Nematology, Volume 53 , 1–11
Article | 24-July-2017
SEM study of the genus. These results confirmed longitudinal amphidial aperture type on lateral sides of the lip region in genus Discotylenchus, as noted by Siddiqi while erecting the genus with D. discretus as the type species. Molecular phylogenetic analyses using partial small subunit (SSU) and large subunit (LSU) rDNA sequences revealed the affinity of the genus Discopersicus n. gen. with members of the subfamily Boleodorinae, as supported by morphological characters (mainly, the oblique
ALI YAGHOUBI,
EBRAHIM POURJAM,
SERGIO A LVAREZ-ORTEGA,
GRACIA LIE´BANAS,
MOHAMMAD REZA ATIGHI,
MAJID PEDRAM
Journal of Nematology, Volume 48 , ISSUE 3, 214–221
Article | 21-July-2017
BEHROUZ GOLHASAN,
RAMIN HEYDARI,
MEHRAB ESMAEILI,
ESMAEIL MIRAEIZ
Journal of Nematology, Volume 49 , ISSUE 1, 67–76
Article | 04-December-2017
monodelphic-prodelphic reproductive system, 15 to 19 mm long conical tail with broad rounded tip, and males absent. The new species is compared with two known species of the genus, Anguillonema poligraphi and A. crenati. Molecular phylogenetic studies of the new species using partial sequences of small subunit (SSU) rDNA revealed that it forms a clade with an unidentified nematode species and two species of the genus Howardula. In phylogenetic analyses using partial sequences of the 28S rDNA (D2-D3
MAHYAR MOBASSERI,
MAJID PEDRAM,
EBRAHIM POURJAM
Journal of Nematology, Volume 49 , ISSUE 3, 286–294
Research Article | 03-September-2018
study. Molecular characterization based on 18SSU rDNA sequencing performed to confirm the taxonomic position of this species and to documents the morphological data. Sequence alignment detects a percent of identity up to 88.0% with other Heteroxynematidae species. Phylogenetic analysis showed that the present recorded is a putative sister taxon to A. tetraptera recorded in a previous study. The SSU rDNA sequence has been deposited in the GenBank under the accession no. MG019400.
Rewaida Abdel-Gaber,
Fathy Abdel-Ghaffar,
Saleh Al Quraishy,
Kareem Morsy,
Rehab Saleh,
Heinz Mehlhorn
Journal of Nematology, Volume 50 , ISSUE 2, 117–132
research-article | 26-March-2021
, the tubes were vortexed (15 sec) and centrifuged at 8,000 rpm for 10 sec. Finally, the tubes were incubated at 56°C for 2 hr followed by incubation at 95°C for 10 min before they were stored at −20°C. The following DNA markers were used to amplify the small and large sub units (SSU and LSU) genes, respectively: SSU F04 (5′-GCTTGTCTCAAAGATTAAGCC-3′), SSU R26 (5′-CATTCTTGGCAAATGCTTTCG-3′) (Blaxter et al., 1998), and D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′), D3B (5′-TCGGAAGGAACCAGCTACTA-3′) (Subbotin et
Chantelle Girgan,
Gerhard Du Preez,
Hendrika Fourie,
Milad Rashidifard
Journal of Nematology, Volume 53 , 1–12
research-article | 01-April-2021
(Fadakar et al., 2020). Three DNA samples were prepared in this way. The DNA samples were stored at −20°C until used in polymerase chain reaction (PCR). The PCR to amplify the partial SSU and D2-D3 expansion segments of LSU rDNA was carried out in a total volume of 35 μl (12.1 μl distilled water, 17.5 μl Taq 2X PCR Master Mix, AMPLIQON, Denmark, 1.2 μl of each primers and 3 μl DNA template). The partial SSU rDNA was amplified using the forward primer F22 (5’–TCCAA GGAAGGCAGCAGGC–3’) (Dorris et al
Reihaneh Gholami Ghavamabad,
Ali Asghar Talebi,
Mohammad Mehrabadi,
Mohammad Ebrahim Farashiani,
Majid Pedram
Journal of Nematology, Volume 53 , 1–16