Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Letter to the Editor
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • critical-appraisal
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • non-scientific
  • Obituary
  • original-paper
  • original-report
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • review-paper
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • short-communication
  • short-report
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • Journal Of Nematology

 

research-article | 30-November-2019

First report of Paratylenchus lepidus Raski, 1975 associated with green tea (Camellia sinensis (L.) Kuntze) in Vietnam

, measurements and pictures were taken using Carl Zeiss Axio Lab. A1 light microscope equipped with a Zeiss Axiocam ERc5s digital camera. For molecular characterization, the D2-D3 region of 28S rDNA and COI mtDNA gene were amplified using D2A/D3B (5′–ACAAGTACCGTGGGGAAAGTTG–3′/5′–TCGGAAGGAACCAGCTACTA–3′) (Subbotin et al., 2006) and JB3/JB4 (5′-TTTTTTGGGCATCCTGAGGTTTAT-3′/5′-TAAAGAAAGAACATAATGAAAATG-3′) (Nguyen et al., 2019b) primers. Forward and reverse sequences were assembled using Geneious R11

Thi Mai Linh Le, Huu Tien Nguyen, Thi Duyen Nguyen, Quang Phap Trinh

Journal of Nematology, Volume 52 , 1–4

Article | 21-July-2017

Mitochondrial Haplotype-based Identification of Root-knot Nematodes (Meloidogyne spp.) on Cut Foliage Crops in Florida

and (ii) evaluate the feasibility of using the mtDNA haplotype as a molecular diagnostic tool for rapid identification of large samples of RKN. A total of 200 Meloidogyne females were collected from cut foliage plant roots. Meloidogyne spp. were identified by PCR and RFLP of mitochondrial DNA. PCR and RFLP of mitochondrial DNA were effective in discriminating the Meloidogyne spp. present. Meloidogyne incognita is the most dominant RKN on cut foliage crops in Florida and must be a high target for

RICHARD BAIDOO, SOUMI JOSEPH, TESFAMARIAM M. MENGISTU, JANETE A. BRITO, ROBERT MCSORLEY, ROBERT H. STAMPS, WILLIAM T. CROW

Journal of Nematology, Volume 48 , ISSUE 3, 193–202

research-article | 30-November-2020

First report and new molecular and morphological characterizations of root-knot nematode, Meloidogyne javanica, infecting ginger and long coriander in Vietnam

of root-knot nematodes, both morphological and molecular characterizations showed that the three most important tropical root-knot nematodes are very closely related (Álvarez-Ortega et al., 2019; Perry et al., 2009). Remarkably, the study of Janssen et al. (2016) proved that some mtDNA genes, especially Nad5 mtDNA gene, are strongly linked with traditional esterase isozyme patterns, and therefore, it can be used as an efficient barcode marker for the reliable identification of tropical root-knot

Ke Long Phan, Thi Mai Linh LE, Huu Tien Nguyen, Thi Duyen Nguyen, Quang Phap Trinh

Journal of Nematology, Volume 53 , 1–8

research-article | 11-March-2021

Morphological and molecular characters of Scutellonema brachyurus (Steiner, 1938) Andrássy, 1958 from South Africa

South Africa (Van den Berg and Heyns, 1973; Van den Berg et al., 2013). The present paper reports S. brachyurus from natural areas of South Africa. The aims of the study were (1) to study new populations of S. brachyurus using morphology, and (2) to study the phylogenetic position of South African S. brachyurus using 28 S rDNA and mtDNA. Materials and methods Nematode extraction and processing Rhizosphere soil samples were collected from the natural grass from North West and Limpopo provinces of

Ebrahim Shokoohi

journal of nematology, Volume 53 , 1–13

research-article | 30-November-2018

New data on known species of Hirschmanniella and Pratylenchus (Rhabditida, Pratylenchidae) from Iran and South Africa

; (ii) to study of morphological variations among different P. hippeastri populations, and (iii) to determine the phylogenetic position of H. anchoryzae from Iran using 28S rDNA and P. hippeastri from South Africa using rDNA and mtDNA genes. Materials and methods Nematode materials In 2015, Hirschmanniella specimens were collected from the rhizosphere of Mentha aquatica in Royan (Mazandaran Province, Iran) and Pratylenchus specimens were collected from rhizosphere soil samples of Cape Willow trees

Ebrahim Shokoohi, Joaquín Abolafia, Phatu William Mashela, Nafiseh Divsalar

Journal of Nematology, Volume 51 , 1–26

research-article | 30-November-2019

Description of Deladenus brevis n. sp. (Sphaerularioidea: Neotylenchidae) from Iran: a morphological and molecular phylogenetic study

species of Deladenus was recovered from a deadwood sample of a dead forest tree collected from the forests of Golestan province, northern Iran. Thus, the present paper aims to describe the newly recovered species and resolve its phylogenetic relationships with other relevant species and genera using three SSU, LSU rDNA, and COI mtDNA markers. Materials and methods Sampling, nematode extraction, mounting, and drawing Specimens of Deladenus brevis n. sp. were obtained from the bark and rotten wood

Fariba Heydari, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 52 , 1–13

research-article | 24-April-2020

First report of southern root-knot nematode, Meloidogyne incognita, infecting pomegranate, Punica granatum, in Peru

identified to species with esterase phenotypes (n = 36 females) (Carneiro and Almeida, 2001); morphology and morphometrics of second-stage juveniles (J2) (n = 30) and females (n = 10), and perineal patterns (n = 15); and molecular characterization of the mitochondrial DNA region between the cytochome oxidase subunit II (COII) and 16 S rRNA genes (mtDNA) using the primers C2F3 (5´-GGTCAATGTTCAGAAATTTGTGG-3´) and 1108 (5´-TACCTTTGACCAATCACGCT-3´) (Powers and Harris, 1993) along with PCR species-specific

Ricardo Andreé Vega-Callo, María Yaquelin Mendoza-Lima, Nataly Ruth Mamani-Mendoza, Leslie Sharon Lozada-Villanueva, Juan José Tamo-Zegarra, Teodocia Gloria Casa-Ruiz, Cristiano Bellé

Journal of Nematology, Volume 52 , 1–3

research-article | 21-October-2020

Chenopodium album is a weed host of Meloidogyne incognita (Nematoda: Meloidogynidae) in Peru

 = 20), and perineal patterns (n = 20 females), esterase phenotypes (n = 36 females), and molecular characterization of the mitochondrial DNA region between the cytochome oxidase subunit II (COII) and 16S rRNA genes (mtDNA) using the primers C2F3 and 1108 (Powers and Harris, 1993); along with PCR species-specific characterized amplified region (SCAR) sequence for confirmation, using a primer set composed of inc-K14-F and inc-K14-R (Randig et al., 2002). The nematode population density observed in

Jorge Airton Gómez-Chatata, Teodocia Gloria Casa-Ruiz, Juan José Tamo-Zegarra, Cristiano Bellé

Journal of Nematology, Volume 52 , 1–4

research-article | 30-November-2018

First report of Meloidogyne javanica (Nematoda: Meloidogynidae) infecting Scoparia dulcis, a medicinal plant in Brazil

between the cytochome oxidase subunit II (COII) and 16S rRNA genes (mtDNA) using the primers C2F3 (5´-GGTCAATGTTCAGAAATTTGTGG-3´) and 1108 (5´-TACCTTTGACCAATCACGCT-3´) (Powers and Harris, 1993) along with PCR species-specific sequence characterized amplified region (SCAR) for confirmation, using a primer set composed of Fjav (5´-GGTGCGCGATTGAACTGAGC-3´) and Rjav (5´-CAGGCCCTTCAGTGGAACTATAC-3´) (Zijlstra et al., 2000). The nematode population density observed in the sample was 1,976 J2s/g of roots. The

Cristiano Bellé, Rodrigo Ferraz Ramos, Andressa Lima de Brida, Tiago Edu Kaspary

journal of nematology, Volume 51 , 1–3

research-article | 30-November-2018

First Report of Scutellonema brachyurus (Steiner, 1938) Andrassy, 1958 and Occurrence of Meloidogyne incognita (Kofoid & White, 1919) Chitwood, 1949 in Belgium

were extracted directly from the galls under a stereomicroscope, using a scalpel and forceps. Perineal patterns were cut and cleaned following Hartman and Sasser (1985) and mounted in glycerine. Microphotographs were made from permanent slides using an Olympus BX51 DIC Microscope equipped with a digital camera. Measurements were made based on the obtained pictures using Image J 1.51 (Schneider et al., 2012). For molecular characterization, primers NAD5F2/NAD5R1 were used to amplify the Nad5 mtDNA

Huu Tien Nguyen, Quang Phap Trinh, Marjolein Couvreur, Phougeishangbam Rolish Singh, Wilfrida Decraemer, Wim Bert

journal of nematology, Volume 51 , 1–6

research-article | 16-April-2019

First report of cultivated Cretan mountain tea (Sideritis syriaca) as a host of Meloidogyne hapla and M. javanica in Crete, with some additional records on the occurrence of Meloidogyne species in Greece

Castillo et al. (2003). The coxII-16S rRNA mtDNA was amplified using primers C2F3 (5′-GGTCAATGTTCAGAAATTTGTGG-3′) (Powers and Harris, 1993) and MRH106 (5′-AATTTCTAAAGACTTTTCTTAGT-3′) (Stanton et al., 1997). The reference M. arenaria, M. incognita , M. javanica and M. hapla Chitwood, 1949 populations from olive trees (Olea europaea L.) (Archidona-Yuste et al., 2018), and M. hispanica from grapevine (Vitis vinifera L.) (Castillo et al., 2009) previously identified and maintained on tomato in the

Emmanuel A. Tzortzakakis, Carolina Cantalapiedra-Navarrete, Antonio Archidona-Yuste, Maria Kormpi, Juan E. Palomares-Rius, Pablo Castillo

Journal of Nematology, Volume 51 , 1–4

research-article | 30-November-2018

First Report of the Root-Knot Nematode, Meloidogyne floridensis Infecting Guardian® Peach Rootstock in South Carolina, USA

TTA AAC AAC-3′) (original primer) for specific amplification of a short fragment of the mtDNA region between COII and 16S rRNA of M. floridensis. PCR products of these gene fragments were obtained and sequenced at Quintara Biosciences (San Francisco, CA). Sequences of nad5 gene (530 bp) and a short fragment between COII and 16S rRNA gene (99 bp) were identical to the reference and other sequences of these genes published for M. floridensis (Smith et al., 2015; Janssen et al., 2016; Westphal et al

Gregory L. Reighard, William G. Henderson, Sarah O. Scott, Sergei. A. Subbotin

journal of nematology, Volume 51 , 1–6

research-article | 30-November-2019

Plant-parasitic nematodes associated with sugarcane in Kilimanjaro, Tanzania

data by taking pictures and measurements using the above camera-equipped microscope. This was followed by DNA extraction from individual nematodes as described in the study of Singh et al. (2018) and the resulting genomic DNA sample was used for the amplification of the partial ITS and D2-D3 region of the 28S of rRNA gene and the COI gene of mtDNA. PCR amplification of the partial ITS was done using the primer pair Vrain2F: 5´-CTTTGTACACACCGCCCGTCGCT-3´/Vrain2R: 5´-TTTCACTCGCCGTTACTAAGGGAATC-3

Phougeishangbam Rolish Singh, Beatrice E. Kashando, Marjolein Couvreur, Gerrit Karssen, Wim Bert

Journal of Nematology, Volume 52 , 1–17

research-article | 30-November-2020

Report of the Texas peanut root-knot nematode, Meloidogyne haplanaria (Tylenchida: Meloidogynidae) from American pitcher plants (Sarracenia sp.) in California

mtDNA genes (Joseph et al., 2016; Khanal et al., 2016; Powers et al., 2005) and rRNA (Ye et al., 2019). Our study also showed distinct discrimination of M. haplanaria from other root-knot nematodes using mitochondrial l-rRNA, COI and nad5 genes. Therefore, mtDNA genes should be considered as more reliable markers for diagnostics of M. haplanaria than rRNA genes. It is noteworthy that the sequences of the D2-D3 of 28S rRNA gene of M. haplanaria from California and Arkansas are very similar with those

Sergei A. Subbotin

Journal of Nematology, Volume 53 , 1–7

Original Research | 18-July-2017

Diversity of Root-knot Nematodes Associated with Tubers of Yam (Dioscorea spp.) Established Using Isozyme Analysis and Mitochondrial DNA-based Identification

identified using enzyme phenotyping (esterase and malate dehydrogenase) and mitochondrial DNA (mtDNA) NADH dehydrogenase subunit 5 (Nad5) barcoding. Examination of 48 populations revealed that yam tubers were infested by Meloidogyne incognita (69%), followed by M. javanica (13%), M. enterolobii (2%), and M. arenaria (2%). Most of the tubers sampled (86%) were infected by a single species, and multiple species of RKN were detected in 14% of the samples. Results of both identification methods revealed the

Yao A. Kolombia, Gerrit Karssen, Nicole Viaene, P. Lava Kumar, Nancy de Sutter, Lisa Joos, Danny L. Coyne, Wim Bert

Journal of Nematology, Volume 49 , ISSUE 2, 177–188

research-article | 24-April-2019

Description of Rotylenchus rhomboides n. sp. and a Belgian population of Rotylenchus buxophilus (Tylenchomorpha: Hoplolaimidae)

morphology and morphometrics along with molecular characteristics and phylogeny of the D2-D3 expansion segment of 28S rDNA, ITS rDNA, and COI mtDNA sequences. Materials and methods Sampling and nematode extraction The soil and root samples were collected around the rhizosphere of banana (Musa basjoo Siebold & Zucc. ex Iinuma) (GPS coordinates N: 51°2′6.8″, E: 3°43′22.7″) and Yam (Dioscorea tokoro) (GPS coordinates: N: 51°2′6.9″, E: 3°43′22.6″) at the Botanical garden of Ghent University. The nematodes

Huu Tien Nguyen, Quang Phap Trinh, Marjolein Couvreur, Phougeishangbam Rolish Singh, Wilfrida Decraemer, Wim Bert

Journal of Nematology, Volume 51 , 1–20

research-article | 30-November-2019

Intraspecific variation in phenotypic and phylogenetic features among Pratylenchus penetrans isolates from Wisconsin, USA

divergence in COI with nematodes confirmed to be P. penetrans by 28S rDNA was between Marathon2-a and the V1B population (Meijel) from the Netherlands (Janssen et al., 2017), at 94.5% similarity. There was no variation in amino acid sequences of P. penetrans populations as a result of SNPs on COI. Table 4. Pairwise distance (percent similarity) for CO1 mtDNA between 13 P. penetrans isolates from Wisconsin. Population Portage 1 Portage 2 Marathon 1 Marathon 2 Chippewa 1 Chippewa 2

Kanan Saikai, Ann E. MacGuidwin

Journal of Nematology, Volume 52 , 1–17

No Record Found..
Page Actions