Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Communications
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Letter to the Editor
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • critical-appraisal
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • in-memomoriam
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • non-scientific
  • Obituary
  • original-paper
  • original-report
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • review-paper
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • serologic-method-review
  • short-communication
  • short-report
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • Polish Journal Of Microbiology
  • Journal Of Nematology

 

Article | 03-December-2017

An 18S rDNA Perspective on the Classification of Criconematoidea

In the nematode family Criconematidae, a taxonomy primarily based on cuticle characters has created classifications that are notoriously volatile. Molecular characters may lead to their stabilization. A phylogenetic tree of Criconematoidea was constructed using 166 new near full-length 18S rDNA sequences and 58 sequences from GenBank. Bayesian and maximum likelihood (ML) analyses produced trees with similar topologies. Major features include a strongly supported clade that includes

THOMAS POWERS, TIMOTHY HARRIS, REBECCA HIGGINS, PETER MULLIN, KIRSTEN POWERS

Journal of Nematology, Volume 49 , ISSUE 3, 236–244

research-article | 06-June-2019

Phylogenetic studies on three Helicotylenchus species based on 28S rDNA and mtCOI sequence data

process as well as to delineate more phylogenetically distant species, which share the same morphology (cryptic species), the support of a molecular approach is needed. To date, only about 20% of Helicotylenchus species has been molecularly characterized using mostly ribosomal DNA fragments (18S, ITS, 28S rDNA; GenBank resources). Mitochondrial cytochrome c oxidase subunit I (mtCOI) sequences were reported for one species, the recently described H. oleae (Palomares-Rius et al., 2018), and a cytochrome

K. Rybarczyk-Mydłowska, E. Dmowska, K. Kowalewska

Journal of Nematology, Volume 51 , 1–17

Research Article | 17-October-2018

Morphological and Molecular Characterization of Labrys filiformis n. sp. (Rhabditida: Tylenchidae) from Iran

duct, offset spermatheca filled with small spheroid sperm cells, 106 to 127 µm long elongate-conoid tail with filiform distal region and finely rounded tip. Molecular phylogenetic analyses were performed using a near-full length fragment of the 18S rDNA and the D2–D3 expansion segments of the 28S rDNA using Bayesian inference and maximum likelihood methods. In the inferred phylogenetic tree with 18S rDNA, the new species has a close affinity with several isolates of the type species, Labrys

Yousef Panahandeh, Joaquín Abolafia, Ebrahim Pourjam, Robin M. Giblin-Davis, Farahnaz Jahanshahi Afshar, Majid Pedram

Journal of Nematology, Volume 50 , ISSUE 3, 343–354

research-article | 26-March-2021

First report of Bitylenchus ventrosignatus (Tobar Jiménez, 1969) Siddiqi, 1986 associated with wild grass in Botswana

at 16,000 rpm (Shokoohi et al., 2020). The supernatant was then extracted from each of the tubes and stored at –20°C. Following this step, the forward and reverse primers, SSU F04 (5’–GCTTGTCTCAAAGATTAAGCC–3’) and SSU R26 (5’–CATTCTTGGCAAATGCTTTCG–3’) (Blaxter et al., 1998) for 18 S rDNA and D2A (5’–ACAAGTACCGTGAGGGAAAGTTG–3’), D3B (5’–TCGGAAGGAACCAGCTACTA–3’) (De Ley et al., 1999) for 28 S rDNA, were used in the PCR reactions for partial amplification of the 18 S rDNA, and 28 S rDNA regions. PCR

Ebrahim Shokoohi

Journal of Nematology, Volume 53 , 1–9

Research Article | 03-September-2018

Molecular Characterization and Phylogeny of Ditylenchus weischeri from Cirsium arvense in the Prairie Provinces of Canada

molecular analysis of many D. weischeri specimens from Canada is presented. Individuals from 41C. arvense or yellow pea grain samples with seeds of C. arvense from the Prairie Provinces were sequenced for the internal transcribed spacer (ITS rDNA), large subunit (LSU) D2D3 28S rDNA, partial segment of small subunit (SSU) 18S rDNA, and the heat shock protein Hsp90 gene. The analysis also included D. weischeri individuals from C. arvense from Russia and garlic with D. dipsaci from the Provinces of Ontario

Mehrdad Madani, Mario Tenuta

Journal of Nematology, Volume 50 , ISSUE 2, 163–182

research-article | 03-June-2019

PCR amplification of a long rDNA segment with one primer pair in agriculturally important nematodes

Eukaryotic nuclear ribosomal DNA (rDNA) is arranged in tandem repeat arrays in the genome. Each repeat unit consists of one copy of small subunit (SSU) 18S, internal transcribed spacers (ITS1 and ITS2), 5.8S, and large subunit (LSU) 28S rDNA, and is separated by an external transcribed spacer (EST) and an intergenic spacer (IGS) (Hillis and Dixon, 1991). The copy number of the repeats within most eukaryotic genomes is high, which provide large quantities of template DNA for PCR. In

L. K. Carta, S. Li

Journal of Nematology, Volume 51 , 1–8

Article | 24-July-2017

Discopersicus n. gen., a New Member of the Family Tylenchidae Örley, 1880 with Detailed SEM Study on Two Known Species of the Genus Discotylenchus Siddiqi, 1980 (Nematoda; Tylenchidae) from Iran

SEM study of the genus. These results confirmed longitudinal amphidial aperture type on lateral sides of the lip region in genus Discotylenchus, as noted by Siddiqi while erecting the genus with D. discretus as the type species. Molecular phylogenetic analyses using partial small subunit (SSU) and large subunit (LSU) rDNA sequences revealed the affinity of the genus Discopersicus n. gen. with members of the subfamily Boleodorinae, as supported by morphological characters (mainly, the oblique

ALI YAGHOUBI, EBRAHIM POURJAM, SERGIO A LVAREZ-ORTEGA, GRACIA LIE´BANAS, MOHAMMAD REZA ATIGHI, MAJID PEDRAM

Journal of Nematology, Volume 48 , ISSUE 3, 214–221

research-article | 30-November-2020

Morphological and molecular characterization of Bitylenchus hispaniensis (Nematoda: Telotylenchidae) from Iran

upon morphological and morphometric characteristics. Additionally, molecular data from LSU D2D3 and ITS rDNA markers were used to study the phylogenetic relationships with others Bitylenchus species. Materials and methods Nematode extraction and morphological observations Several soil samples were collected from the rhizosphere of euphrates poplar (Populus euphratica Oliv.) trees in Khuzestan province, Iran. Centrifugal – flotation technique (Jenkins, 1964) or the tray method (Whitehead and

Abbas Abdolkhani, Sedighe Azimi

Journal of Nematology, Volume 53 , 1–10

research-article | 14-December-2020

Morphological, morphometrical, and molecular characterization of Metarhabditis amsactae (Ali, Pervez, Andrabi, Sharma and Verma, 2011) Sudhaus, 2011 (Rhabditida, Rhabditidae) from India and proposal of Metarhabditis longicaudata as a junior synonym of M. amsactae

Jacob, 2012, and Oscheius amsactae Ali, Pervez, Andrabi, Sharma and Verma, 2011 and Metarhabditis longicaudata Tabassum, Salma and Nasir, 2019. Most of these studies, however, have characterized the species morphologically and morphometrically. Regarding molecular analysis, several Internal Transcribed Spacer (ITS) rDNA sequences, obtained from M. amsactae isolated in India, Philippines, and Pakistan have been deposited in the GenBank, but none of the nematode specimens used to obtain the sequences

Aashaq Hussain Bhat, Shreyansh Srivastava, Aasha Rana, Ashok Kumar Chaubey, Ricardo A. R. Machado, Joaquín Abolafia

Journal of Nematology, Volume 52 , 1–23

Research Article | 03-September-2018

Morphological Re-Description and 18 S rDNA Sequence Confirmation of the Pinworm Aspiculuris tetraptera (Nematoda, Heteroxynematidae) Infecting the Laboratory Mice Mus musculus

study. Molecular characterization based on 18SSU rDNA sequencing performed to confirm the taxonomic position of this species and to documents the morphological data. Sequence alignment detects a percent of identity up to 88.0% with other Heteroxynematidae species. Phylogenetic analysis showed that the present recorded is a putative sister taxon to A. tetraptera recorded in a previous study. The SSU rDNA sequence has been deposited in the GenBank under the accession no. MG019400.

Rewaida Abdel-Gaber, Fathy Abdel-Ghaffar, Saleh Al Quraishy, Kareem Morsy, Rehab Saleh, Heinz Mehlhorn

Journal of Nematology, Volume 50 , ISSUE 2, 117–132

research-article | 30-November-2019

On the identity of Eucephalobus oxyuroides (de Man, 1876) Steiner, 1936 (Rhabditida, Cephalobidae), with an updated taxonomy of the genus and notes about its phylogeny

microscopy (SEM) Specimens preserved in glycerine were selected for observation under SEM according to the methods of Abolafia (2015). They were hydrated in distilled water, dehydrated in a graded ethanol-acetone series, critical point dried, coated with gold, and observed with a Zeiss Merlin microscope (5 kV) (Zeiss, Oberkochen, Germany). Phylogenetic analyses For phylogenetic relationships, analyses were based on 18S and 28S rDNA gene sequences available in GenBank. The sequences were aligned using

Joaquín Abolafia, Reyes Peña-Santiago

Journal of Nematology, Volume 52 , 1–20

research-article | 30-November-2018

Morphological and Molecular Characterization of Oscheius saproxylicus sp. n. (Rhabditida, Rhabditidae) From Decaying Wood in Spain, With New Insights into the Phylogeny of the Genus and a Revision of its Taxonomy

Applied Biosystems Hitachi 3500 Genetic Analyzer. The sequences obtained were submitted to the GenBank database. Phylogenetic analyses For phylogenetic relationships, analyses were based on 18S and 28S rDNA. The newly obtained sequences were manually edited using BioEdit 7.2.6 (Hall, 1999) and aligned with another 18S or 28S rRNA gene sequences available in GenBank using Muscle alignment tool implemented in the MEGA7 (Kumar et al., 2016). The ambiguously aligned parts and divergent regions were

Joaquín Abolafia, Reyes Peña-Santiago

journal of nematology, Volume 51 , 1–21

research-article | 30-November-2019

First report of Paratylenchus lepidus Raski, 1975 associated with green tea (Camellia sinensis (L.) Kuntze) in Vietnam

, measurements and pictures were taken using Carl Zeiss Axio Lab. A1 light microscope equipped with a Zeiss Axiocam ERc5s digital camera. For molecular characterization, the D2-D3 region of 28S rDNA and COI mtDNA gene were amplified using D2A/D3B (5′–ACAAGTACCGTGGGGAAAGTTG–3′/5′–TCGGAAGGAACCAGCTACTA–3′) (Subbotin et al., 2006) and JB3/JB4 (5′-TTTTTTGGGCATCCTGAGGTTTAT-3′/5′-TAAAGAAAGAACATAATGAAAATG-3′) (Nguyen et al., 2019b) primers. Forward and reverse sequences were assembled using Geneious R11

Thi Mai Linh Le, Huu Tien Nguyen, Thi Duyen Nguyen, Quang Phap Trinh

Journal of Nematology, Volume 52 , 1–4

research-article | 30-November-2018

New data on known species of Hirschmanniella and Pratylenchus (Rhabditida, Pratylenchidae) from Iran and South Africa

(Majd Taheri et al., 2013). Those species have been studied by morphological characters except for two unknowns which have been studied by morphological and molecular DNA barcoding using 28S rDNA (Majd Taheri et al., 2013). Root-lesion nematodes, Pratylenchus (Filipjev, 1936), are after root-knot and cyst nematodes listed as the third economically most important genus that adversely affects crop production worldwide (Castillo and Vovlas, 2007; Jones et al., 2013). Pratylenchus hippeastri, the

Ebrahim Shokoohi, Joaquín Abolafia, Phatu William Mashela, Nafiseh Divsalar

Journal of Nematology, Volume 51 , 1–26

research-article | 28-April-2020

Morphological and molecular characterization of Acrobeloides saeedi Siddiqi, De Ley and Khan, 1992 (Rhabditida, Cephalobidae) from India and comments on its status

microscopy (LM) and scanning electron microscopy (SEM). Additionally, molecular data of this species based in the D2-D3 region of the 28 S rDNA, 18 S rDNA, and internal transcribed spacer (ITS) regions of rDNA genes are included to support the morpho-taxometrical studies. This is the first molecular study of this species and its first valid report from India. Materials and methods Nematode isolation, culture, and processing Soil samples were collected from agricultural farmlands in Mawana, Meerut (28°9

Aasha Rana, Aashaq Hussain Bhat, Suman Bhargava, Ashok Kumar Chaubey, Joaquín Abolafia

Journal of Nematology, Volume 52 , 1–21

research-article | 03-August-2021

The Diversity of the Endobiotic Bacterial Communities in the Four Jellyfish Species

bacterial communities were screened by 16S rDNA sequencing in the four common species of jellyfish including Phyllorhiza punctata, Cyanea capillata, Chrysaora melanaster and Aurelia coerulea, to evaluate the diversity and richness as well as their potential functions involving the life of the four different jellyfish species. Experimental Materials and Methods Jellyfish samples. Individuals of four jellyfish species (P. punctata, C. capillata, C. melanaster, and A. coerulea) were collected alive from

QING LIU, XINTONG CHEN, XIAOYA LI, JIANPING HONG, GUIXIAN JIANG, HONGYU LIANG, WENWEN LIU, ZHENG XU, JING ZHANG, WEI WANG, LIANG XIAO

Polish Journal of Microbiology, Volume 68 , ISSUE 4, 465–476

research-article | 30-November-2020

Morphological and molecular characterization of Filenchus pseudodiscus n. sp. from east Golestan province, north Iran; with an updated phylogeny of Malenchus Andrássy, 1968 (Tylenchomorpha: Tylenchidae)

in 15 µl TE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0, Qiagen) (four DNA samples were prepared for each species) after their examination on temporary slides. DNA samples were stored at ‒20°C until used as PCR templates. Partial sequence of the SSU rDNA gene was amplified using primers 988F (5′-CTCAAAGATTAAGCCATGC-3′), 1912R (5′-TTTACGGTCAGAACTAGGG-3′), 1813F (5′-CTGCGTGAGAGGTGAAAT-3′) and 2646R (5′-GCTACCTTGTTACGACTTTT-3′) with resulting PCR products ranging from 890 to 930 and 970 to 1,017 bp

Parnaz Mortazavi, Fariba Heydari, Joaquín Abolafia, Pablo Castillo, Majid Pedram

Journal of Nematology, Volume 53 , 1–14

research-article | 01-October-2021

Redescription and phylogenetic analysis of the type species of the genus Panagrellus Thorne, 1938 (Rhabditida, Panagrolaimidae), P. pycnus Thorne, 1938, including the first SEM study

, Progen Scientific, London, UK). The bands were stained with 1.25 µl RedSafe (20,000x) previously added to the agarose gel solution (25 ml). The sequencing reactions of the PCR products were performed at Sistemas Genómicos (Paterna, Valencia, Spain) according the Sanger et al. (1977) method. The DNA sequences obtained for P. pycnus (MZ656001 for the 18S rDNA and MZ656000 for the 28S rDNA) and Tarantobelus arachnicida Abolafia and Peña-Santiago, 2018 (MZ655998–MZ655999 for the 18S rDNA and MZ656002

Joaquín Abolafia, Matteo Vecchi

Journal of Nematology, Volume 53 , 1–20

Research Article | 03-September-2018

Stauratostoma shelleyi n. gen., n. sp. (Nematoda: Rhabditida: Thelastomatidae) from Appalachian Polydesmid Millipedes (Polydesmida: Xystodesmidae)

stomatal opening formed from four flaps; greatly expanded labial disc; and eight-sectored annule-like column supporting the labial disc. Thirteen nematodes from various hosts were sequenced for 28S LSU rDNA and compared with other millipede-inhabiting nematodes. Stauratostoma shelleyi is the sister group to the few Thelastoma spp. that have been molecularly characterized using the D2–D3 expansion segments of the 28S LSU rDNA.

Gary Phillips, Robert J. Pivar, Xiocaun Sun, John K. Moulton, Ernest C. Bernard

Journal of Nematology, Volume 50 , ISSUE 2, 133–146

Research Article | 31-May-2018

Incidence of Oscheius onirici (Nematoda: Rhabditidae), a potentially entomopathogenic nematode from the marshlands of Wisconsin, USA

In a search for an entomopathogenic nematode to control cranberry insect pests, three Oscheius populations (Rhabditidae) were recovered through the Galleria-bait method from one sample taken in a wild cranberry marsh in Jackson County, Wisconsin, USA. Morphological studies with light microscopy and scanning electron microscopy, as well as molecular analyses of the near-full-length small subunit rDNA gene, D2/D3 expansion segments of the large subunit rDNA gene, internal transcribed spacer, and

Weimin Ye, Shane Foye, Ann E. MacGuidwin, Shawn Steffan

Journal of Nematology, Volume 50 , ISSUE 1, 9–26

research-article | 30-November-2019

First report of Xiphinema hunaniense Wang & Wu, 1992 (Nematoda: Longidoridae) in Vietnam

. A1 light microscope equipped with a Zeiss Axiocam ERc5s digital camera. For molecular characterization, the 5′-end region of 28S rDNA was amplified using DP391/501 primers (5′-AGCGGAGGAAAAGAAACTAA-3′/5′-TCGGAAGGAACCAGCTACTA-3′) following Nguyen et al. (2019b). Forward and reverse sequences were assembled and analyzed using Geneious R11 (Nguyen et al., 2019b, 2019c). The best fit model was chosen using Mega 7 following Nguyen et al. (2019b). Results and discussion Measurements Eight females: L

Huu Tien Nguyen, Thi Duyen Nguyen, Thi Mai Linh Le, Quang Phap Trinh

Journal of Nematology, Volume 52 , 1–4

research-article | 30-November-2019

Oostenbrinkia pedrami n. sp. (Dorylaimida: Aulolaimoididae) from Iran, with molecular phylogenetic relationships to some other Dorylaimida Pearse, 1942

) buffer (10 mM Tris-Cl, 0.5 mM EDTA, pH 9.0, Qiagen) on a clean slide, and squashed using a clean slide cover with the aid of a pipette tip. The suspension was collected by adding 20 μl of TE buffer after gently removing the slide cover and leaving the solution on the slide (Pedram, 2017). The DNA sample was stored at −20°C until used as the polymerase chain reaction (PCR) template. The near-full-length sequence of the small subunit ribosomal DNA (SSU rDNA) was amplified using the forward primer 18S4

Farahnaz Jahanshahi Afshar

Journal of Nematology, Volume 52 , 1–7

research-article | 30-November-2019

Description of Deladenus brevis n. sp. (Sphaerularioidea: Neotylenchidae) from Iran: a morphological and molecular phylogenetic study

species of Deladenus was recovered from a deadwood sample of a dead forest tree collected from the forests of Golestan province, northern Iran. Thus, the present paper aims to describe the newly recovered species and resolve its phylogenetic relationships with other relevant species and genera using three SSU, LSU rDNA, and COI mtDNA markers. Materials and methods Sampling, nematode extraction, mounting, and drawing Specimens of Deladenus brevis n. sp. were obtained from the bark and rotten wood

Fariba Heydari, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 52 , 1–13

research-article | 30-November-2020

Description of Spinocephalus tessellatus n. gen., n. sp. (Rhabditida, Cephalobidae) from Iran, a nematode with a new morphological pattern at lip region

verify the amplification using an electrophoresis system (Labnet Gel XL Ultra V–2, Progen Scientific, London, UK). The bands were stained with RedSafe (20,000x) previously added to the agarose gel solution. The sequencing reactions of the PCR products were performed at Sistemas Genómicos (Paterna, Valencia, Spain) according the Sanger et al. (1977) method. The rDNA sequences obtained for Spinocephalus tessellatus n. gen., n. sp. were submitted to the GenBank database. Phylogenetic analyses For

Joaquín Abolafia, Manouchehr Hosseinvand, Ali Eskandari

Journal of Nematology, Volume 53 , 1–16

research-article | 11-March-2021

Morphological and molecular characters of Scutellonema brachyurus (Steiner, 1938) Andrássy, 1958 from South Africa

South Africa (Van den Berg and Heyns, 1973; Van den Berg et al., 2013). The present paper reports S. brachyurus from natural areas of South Africa. The aims of the study were (1) to study new populations of S. brachyurus using morphology, and (2) to study the phylogenetic position of South African S. brachyurus using 28 S rDNA and mtDNA. Materials and methods Nematode extraction and processing Rhizosphere soil samples were collected from the natural grass from North West and Limpopo provinces of

Ebrahim Shokoohi

journal of nematology, Volume 53 , 1–13

research-article | 30-November-2020

Discopersicus hexagrammatus n. sp. (Rhabditida: Tylenchidae), the second species of the genus

Tanha Maafi et al. (2003), and used as template for polymerase chain reaction (PCR). The D2-D3 expansion segments of 28S rDNA were amplified using the forward D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and reverse D3B (5′-TCGGAAGGAACCAGCTACTA-3′) primers (Nunn, 1992). Each PCR reaction mixure with a final volume of 30 μl, contained: 15 μl Taq DNA Polymerase 2x Master Mix RED (Ampliqon, Denmark), 1 μl (10 pmol μl−1) of each forward and reverse primers, 2 μl of DNA template and 11 μl deionised water

Manouchehr Hosseinvand, Ali Eskandari, Joaquín Abolafia, Reza Ghaderi

journal of Nematology, Volume 53 , 1–10

Article | 21-July-2017

Description of Enchodorus yeatsi n. sp. (Dorylaimida, Nordiidae) from Southern Iran and Its Molecular Phylogenetic Study

sequences of 28S rDNA D2/D3 and internal transcribed spacer 1 (ITS1) fragments. Compared to Enchodorus neodolichurus, it has basic differences in tail characters and spicule lengths. Molecular phylogenetic studies using partial sequences of 28S rDNA D2/D3 fragment of the new species and available sequences of Nordiidae members and several other dorylaim species/genera, revealed E. yeatsi n. sp. and E. dolichurus forming a clade with 0.81 Bayesian posterior probability (BPP). This

MAJID PEDRAM

Journal of Nematology, Volume 49 , ISSUE 1, 21–26

research-article | 30-November-2020

New insights into the identity of Discolaimium dubium Das, Khan and Loof, 1969 (Dorylaimida) as derived from its morphological and molecular characterization, with the proposal of its transference to Aporcella Andrássy, 2002

containing 25.65 μl ddH2O, 2.85 μl 10 × PCR buffer and 1.5 μl proteinase K (600 μg/ml) (Promega, Benelux, the Netherlands). The tubes were incubated at −80°C (1 hr), 65°C (1 hr) and 95°C (15 min). Each sample was regarded as an independent DNA sample and stored at −20°C until used as polymerase chain reaction (PCR) template. Primers for 28S rDNA D2-D3 amplification/sequencing were forward primer D2A (5´-ACAAGTACCGTGAGGGAAAGTTG-3´) and reverse primer D3B (5´-TCGGAAGGAACCAGCTACTA-3´) (Nunn, 1992). The 25

Nasir Vazifeh, Gholamreza Niknam, Habibeh Jabbari, Arezoo Naghavi, Reyes Peña-Santiago

Journal of Nematology, Volume 53 , 1–12

research-article | 30-November-2018

Data of an Iranian Population of L. proximus Sturhan & Argo, 1983, with taxonomic revision of L. israelensis Peneva, Orion, Shlevin, Bar-Eyal & Brown, 1998 (Nematoda: Longidoridae) and Proposal for a New Synonymy

transferred to a small drop of TE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0, QIAGEN Inc., Valencia, CA) individually on separate clean slides, and each specimen was squashed using a clean slide cover glass. The suspension was collected by adding 50 μl TE buffer. Each sample was regarded as an independent DNA sample, and stored at −20°C until used as polymerase chain reaction (PCR) template. Primers used for the PCR amplification of the D2–D3 expansion domains of the LSU rDNA were forward D2A (5

Mazdosht Giti, Leila Kashi, Majid Pedram

journal of nematology, Volume 51 , 1–11

Article | 24-July-2017

Cryptaphelenchus varicaudatus n. sp. (Rhabditida: Ektaphelenchinae) from Tehran Province, Iran

of small subunit (SSU) and large subunit (LSU) rDNA D2/D3 fragments, the new species formed a clade with two currently available GenBank-derived, unspecified isolates/sequences in SSU and three other isolates/sequences in LSU trees, respectively.

MAJID PEDRAM

Journal of Nematology, Volume 49 , ISSUE 2, 223–230

Research Article | 31-May-2018

Delatylus andersoni n. gen., n. sp. (Nematoda: Neotylenchidae) Isolated from White Pine (Pinus monticola) Lumber from USA and Intercepted in Ningbo, China

Three populations of neotylenchid nematodes were isolated in Ningbo, P. R. China, from white pine lumber (Pinus monticola) imported from the USA. The nematodes were morphologically intermediate between Hexatylus and Deladenus. The nematodes were molecularly characterized based on sequences of the rDNA small subunit 18S, large subunit 28S D2/D3, and internal transcribed spacer sequences. The phylogenetic inferences placed the nematodes with other neotylenchid nematodes, i.e., Fergusobia and

Qing Yu, Maria Munawar, Jianfeng Gu, Weimin Ye

Journal of Nematology, Volume 50 , ISSUE 1, 69–76

research-article | 30-November-2020

Description of Longidorella (Saevadorella) caspica n. sp. (Dorylaimida: Nordiidae) from north Iran

adding 15 μl TE buffer. The DNA sample was stored at −20°C. Primers for 28S rDNA D2-D3 amplification/sequencing were forward primer D2A (5´-ACAAGTACCGTGAGGGAAAGT-3´) and reverse primer D3B (5´-TCGGAAGGAACCAGCTACTA-3´) (Nunn, 1992). The PCR cycles and sequencing of amplified fragments were according to Jahanshahi Afshar et al. (2019) and sequenced directly for both strands using the same primers with an ABI 3730XL sequencer (Bioneer Corporation, South Korea). The newly generated sequence for the new

Fariba Heydari, Mohammad Reza Atighi, Ebrahim Pourjam, Majid Pedram

Journal of Nematology, Volume 53 , 1–11

research-article | 30-November-2019

Morphological and molecular characterization of two species of Neothada Khan, 1973 (Nematoda: Tylenchidae) from Iran, with notes on N. cancellata

followed as described by Tanha Maafi et al. (2003). Fragments of D2-D3 expansion segments of 28 S rDNA were amplified using the forward D2A (5’–ACAAGTACCGTGAGGGAAAGT–3’) and reverse D3B (5’–TCGGAAGGAACCAGCTACTA–3’) primers (Nunn, 1992). The 30 μl PCR contained 15 μl Taq DNA Polymerase 2 × MasterMix (Ampliqon, Denmark), 1 μl (10 pmol μl−1) each of forward and reverse primers, 2 μl of DNA template and 11 μl deionised water. This mixture was placed into a Hybaid Express thermal cycler (Hybaid, Ashford

Manouchehr Hosseinvand, Ali Eskandari, Reza Ghaderi

Journal of Nematology, Volume 52 , 1–10

Original Paper | 30-June-2018

The Heavy-Metal Resistance Determinant of Newly Isolated Bacterium from a Nickel-Contaminated Soil in Southwest Slovakia

A bacterial isolate MR-CH-I2 [KC809939] isolated from soil contaminated mainly by high nickel concentrations in southwest Slovakia was previously found carrying nccA-like heavy-metal resistance determinant, marked as MR-CH-I2-HMR [KF218096]. According to phylogenetic analysis of short (696 bp) 16S rDNA (16S rRNA) sequences this bacterium was tentatively assigned to Uncultured beta proteobacterium clone GC0AA7ZA05PP1 [JQ913301]. nccA-like gene product was on the same base of its partial (581 bp

MATEJ REMENÁR, ANNA KAMLÁROVÁ, JANA HARICHOVÁ, MARCEL ZÁMOCKÝ, PETER FERIANC

Polish Journal of Microbiology, Volume 67 , ISSUE 2, 191–201

Article | 21-July-2017

First Report and Comparative Study of Steinernema surkhetense (Rhabditida: Steinernematidae) and its Symbiont Bacteria from Subcontinental India

isolates possess six ridges in their lateral field instead of eight reported in the original description. The analysis of ITS-rDNA sequences revealed nucleotide differences at 345, 608, and 920 positions in aligned data. No difference was observed in D2-D3 domain. The S. surkhetense COI gene was studied for the first time as well as the molecular characterization of their Xenorhabdus symbiont using the sequences of recA and gyrB genes revealing Xenorhabdus stockiae as its symbiont

AASHIQ HUSSAIN BHAT, I STKHAR, ASHOK KUMAR CHAUBEY, VLADIMIR PUZA, ERNESTO SAN-BLAS

Journal of Nematology, Volume 49 , ISSUE 1, 92–102

research-article | 16-January-2021

Occurrence and molecular characterization of Meloidogyne graminicola on rice in Central Punjab, Pakistan

segments of the 18 S, ITS1, 5.8 S, ITS2, and 28 S regions of the ribosomal DNA array (rDNA) and mitochondrial DNA (mtDNA) have proved to be efficient diagnostic tools for accurately identifying of RKNs (Landa et al., 2008; Naz et al., 2012). Accurate identification of M. graminicola, as well as its prevalence and distribution spectra, is fundamental for applying management strategies in the field. Therefore, we used morphological and molecular approaches to identify RKNs in order to determine the

Abdul Jabbar, Nazir Javed, Anjum Munir, Huma Abbas, Sajid A. Khan, Anam Moosa, Muhammad Jabran, Byron J. Adams, Muhammad A. Ali

Journal of Nematology, Volume 52 , 1–17

Research Article | 03-December-2018

Improved 18S small subunit rDNA primers for problematic nematode amplification

L. K. Carta, S. Li

Journal of Nematology, Volume 50 , ISSUE 4, 533–542

research-article | 30-November-2020

Laimaphelenchus africanus n. sp. (Tylenchomorpha: Aphelenchoididae) from South Africa, a morphological and molecular phylogenetic study, with an update to the diagnostics of the genus

. The specimens were then transferred to two individual Eppendorf tubes containing 15 µl ddH2O and their respective DNA was extracted using the chelex-100 protocol of Rashidifard et al. (2019). The DNA samples were stored at –20°C until used for amplification. The partial sequences of the large subunit ribosomal DNA (LSU rDNA D2-D3) were amplified using forward primer D2A (5′–ACAAGTACCGTGAGGGAAAGT–3′) and reverse primer D3B (5′–TCGGAAGGAACCAGCTACTA–3′) (Nunn, 1992). The polymerase chain reaction (PCR

Farahnaz Jahanshahi Afshar, Milad Rashidifard, Joaquín Abolafia, Miloslav Zouhar, Hendrika Fourie, Majid Pedram

Journal Of Nematology, Volume 53 , 1–14

Research Article | 03-September-2018

Description of Longidorus azarbaijanensis n. sp. (Dorylaimida: Longidoridae) from Iran

. sturhani. The morphological differences of the new species with the aforementioned species are discussed. For all the aforementioned species (except L. protae, currently lacking molecular data) the differences of the new species was also confirmed with differences in molecular sequences of D2-D3 expansion domains of 28S rDNA and the corresponding phylogenetic analyses. The partial sequence of the internal transcribed spacer 1 (ITS1) of the new species was also used in phylogenetic analyses. In partial

Farshad Gharibzadeh, Ebrahim Pourjam, Majid Pedram

Journal of Nematology, Volume 50 , ISSUE 2, 207–218

research-article | 16-April-2019

Description of a new dagger nematode, Xiphinema barooghii n. sp. (Nematoda: Longidoridae) and additional data on the three known species of the genus from northwest of Iran

phylogenetic tree (Fig. 5). Phylogenetic analyses The newly obtained sequences were aligned using MEGA6 (Tamura et al., 2013) and compared with other Xiphinema D2–D3 expansion segment of 28S rDNA gene sequences available in GenBank using the Nblast homology search program. Longidorus helveticus (Lamberti et al., 2001) (AY601566) was chosen as out group. The best-fitted model of DNA evolution was obtained using MrModeltest 2.3 (Nylander, 2004) with the Akaike Information Criterion (AIC). Phylogenetic

Nasir Vazifeh, Gholamreza Niknam, Habibeh Jabbari, Arezoo Naghavi

Journal of Nematology, Volume 51 , 1–17

research-article | 25-May-2020

Morphological and molecular characterization of Ektaphelenchoides pini (Massey, 1966) Baujard, 1984 (Aphelenchoididae; Ektaphelenchinae) from Iran, with morphological and taxonomic observations on some species

specimen of the recovered species was picked out, examined on a temporary slide and transferred to a small drop of TE buffer (10 mMTris-Cl, 0.5 mM EDTA, pH 9.0; Qiagen) on a clean slide and crushed using a cover slip. The suspension was collected by adding 20 μl TE buffer. The DNA sample was stored at −20°C until used as PCR template (two separate females were used for this purpose, and two DNA samples were prepared). The SSU rDNA was amplified using the forward primer F22 (5´-TCCAAGGAAGGCAGCAGGC-3

Fariba Heydari, Majid Pedram

Journal of Nematology, Volume 52 , 1–12

research-article | 30-March-2020

Characterization of Vittatidera zeaphila (Nematoda: Heteroderidae) from Indiana with molecular phylogenetic analysis of the genus

. To prepare DNA extracts, frozen nematodes were thawed, 1 µl proteinase K (from 2 mg/ml stock solution) was added, and the tubes were incubated at 60°C for 60 min, followed by 95°C for 15 min to deactivate the proteinase K. Two or five microliters of extract were used for each PCR reaction. PCR amplification and cloning ITS: Amplification of the internal transcribed spacer region ITS1&2 rDNA contained 0.2 µM each primer, TW81 (Joyce et al., 1994) and AB28 (Howlett et al., 1992), 1.5 mM MgCl2

Andrea M. Skantar, Zafar A. Handoo, Mihail R. Kantor, Lynn K. Carta, Jamal Faghihi, Virginia Ferris

Journal of Nematology, Volume 52 , 1–8

Original Paper | 10-December-2018

Aspergillus penicillioides Speg. Implicated in Keratomycosis

of the following rDNA regions: ITS1, ITS2, 5.8S, 28S rDNA, LSU and β-tubulin were carried out for the isolates studied. A high level of similarity was found between sequences from certain rDNA regions, i.e. ITS1-5.8S-ITS2 and LSU, what confirmed the classification of the isolates to the species A. penicillioides. The classification of our isolates to A. penicillioides species was confirmed also by the phylogenetic analysis.

EULALIA MACHOWICZ-MATEJKO, AGNIESZKA FURMAŃCZYK, EWA DOROTA ZALEWSKA

Polish Journal of Microbiology, Volume 67 , ISSUE 4, 407–416

research-article | 30-November-2019

First report of the stubby-root nematode Nanidorus minor infecting Paspalum vaginatum, seashore paspalum grass in Georgia, USA

, the mixture was incubated at room temperature (23 ± 2°C) for 10 min and then at 95°C for 3 min. Finally, 20 µL of neutralization solution was added to the tube and vortexed briefly. This DNA extract was stored at −20°C and used as DNA template for PCR reactions in 2 µL aliquots. Three primer pairs targeting 18S rDNA (360F/932R), 28S rDNA (D2A/D3B) and ITS1 rDNA (BL18/5818) (Riga et al., 2007; Duarte et al., 2010; Ye et al., 2015) were used in singleplex PCR (Hajihassani et al., 2018a). The

Ganpati B. Jagdale, Fereidoun Forghani, Katherine Martin, Abolfazl Hajihassani, Alfredo Dick Martinez-Espinoza

Journal of Nematology, Volume 52 , 1–3

research-article | 30-November-2020

First report of rice root-knot nematode, Meloidogyne graminicola, infecting Juncus microcephalus in Brazil

observed by electrophoresis revealed the phenotype VS-1 (G1) (Rm = 0.70) typical of M. graminicola (Carneiro et al., 1996). The sequences of the rDNA regions (ITS: 433 bp and D2-D3 of 28S: 446 bp) were submitted to GenBank (ITS: MW537706 and D2-D3 of 28S: MW537709). Searches on BLAST showed 99 to 100% identity with sequences of M. graminicola isolates from Brazil, Taiwan, and China. To satisfy a modified Koch’s postulates, J. microcephalus plantlets were grown in 1.7 L pots filled with a sterilized

Cristiano Bellé, Paulo Sergio dos Santos, Tiago Edu Kaspary

Journal of Nematology, Volume 53 , 1–4

Research Article | 03-December-2018

First report of Bursaphelenchus antoniae from Pinus strobus in the U.S.

Juvenile, female and male nematodes were discovered in wood chips of white pine Pinus strobus from Ashley Falls, MA. Initial observations suggested these nematodes might be PWN, but closer morphological and molecular characterization proved otherwise. Comparison of measured features with those in the literature indicated this nematode population had some unique characteristics. The specimens were identified as Bursaphelenchus antoniae Penas et al., 2006 based on 18S rDNA molecular sequence vs

Lynn K. Carta, R. L. Wick

Journal of Nematology, Volume 50 , ISSUE 4, 473–478

research-article | 30-November-2020

First report of Mesocriconema sphaerocephalum (Taylor, 1936) Loof, 1989 associated with wild grass in Botswana

″) (De Ley et al., 1999), were used in the PCR reactions for partial amplification of the 18S and 28S rDNA region, respectively. PCR was conducted with 8 μl of the DNA template, 12.5 μl of 2X PCR Master Mix Red (Promega, USA) for the Botswanan specimens, 1 μl of each primer (10 pmol μl−1), and ddH2O for a final volume of 30 μl. The amplification was processed using an Eppendorf master cycler gradient (Eppendorf, Hamburg, Germany), with the following program: initial denaturation for 3 min at 94°C, 37

Ebrahim Shokoohi

Journal of Nematology, Volume 53 , 1–5

Original Research | 11-December-2017

Description of Pseudacrobeles (Pseudacrobeles) curvatus sp. n. (Cephalobidae: Rhabditida) in South Korea

and diagnostic features of Pseudacrobeles species and molecular sequence data from the D2-D3 regions of the 28S ribosomal DNA (rDNA) and ITS1-5.8S-ITS2 region of rDNA from the new species, which can be used as molecular barcode sequences.  

Jiyeon Kim, Taeho Kim, Joong-Ki Park

Journal of Nematology, Volume 49 , ISSUE 2, 162–167

research-article | 30-November-2020

Description of Prionchulus jonkershoekensis n. sp. (Nematoda: Mononchida), a new predatory species from South Africa

species was characterized using both morphological and molecular techniques, its phylogenetic relationships are also discussed based on 18 S and 28 S rDNA genes. Materials and methods Nematode extraction and processing Prionchulus jonkershoekensis n. sp. specimens were extracted from leaf-litter samples collected from one locality in the Jonkershoek Mountains by using the Baermann tray method (Hooper and Evans, 1993). Nematodes were heat-killed and fixed using the glycerol-ethanol method of

Candice Jansen van Rensburg, Hendrika Fourie, Samad Ashrafi, Milad Rashidifard

Journal of Nematology, Volume 53 , 1–10

research-article | 30-November-2020

Steinernema sandneri n. sp. (Rhabditida: Steinernematidae), a new entomopathogenic nematode from Poland

same species) controls were performed. All the treatments were replicated 30 times for each combination of the nematode species and observed for 20 consecutive days at 17.5°C. Molecular characterization and phylogenetic analysis DNA was extracted from three single virgin first-generation females of nematodes using a DNeasy Blood and Tissue Kit (Qiagen, Germany). PCR amplification of the internal transcribed spacer (ITS) region of rDNA, the D2D3 region of 28 S rDNA, and the mitochondrial cox1 gene

Magdalena Lis, Ewa Sajnaga, Marcin Skowronek, Adrian Wiater, Kamila Rachwał, Waldemar Kazimierczak

Journal of Nematology, Volume 53 , 1–24

Article | 03-December-2017

Morphological and Molecular Identification of Longidorus euonymus and Helicotylenchus multicinctus from the Rhizosphere of Grapevine and Banana in Greece

EMMANUEL A. TZORTZAKAKIS, CAROLINA CANTALAPIEDRA-NAVARRETE, PABLO CASTILLO, JUAN E. PALOMARES-RIUS, ANTONIO ARCHIDONA-YUSTE

Journal of Nematology, Volume 49 , ISSUE 3, 233–235

research-article | 24-November-2020

Description of Heterodera microulae sp. n. (Nematoda: Heteroderinae) from China – a new cyst nematode in the Goettingiana group

diagnosis is gaining more reliability for precise and accurate identification of cyst-forming nematodes (Peng et al., 2003). The internal transcribed spacer region of the ribosomal DNA (ITS-rDNA), the D2 and D3 expansion fragments of the 28S ribosomal DNA genes (D2-D3 of 28S-rDNA), and mitochondrial DNA (COI gene) units are good candidate genes for molecular taxonomic and phylogenetic studies (Subbotin et al., 2001; Subbotin et al., 2006; Madani et al., 2004; Vovlas et al., 2017). Based on

Wenhao Li, Huixia Li, Chunhui Ni, Deliang Peng, Yonggang Liu, Ning Luo, Xuefen Xu

Journal of Nematology, Volume 52 , 1–16

research-article | 30-November-2018

First report of Mesocriconema sphaerocephalum (Taylor, 1936) Loof, 1989 associated with carrot (Daucus carota subsp. Stativus) in Vietnam

Zeiss Axio Lab.A1 light microscope. Measurements and pictures were taken using a ZEN lite software on ZEISS Axiocam ERc5s digital camera (Nguyen et al., 2017). For molecular studies, Primers D2A (5′-ACAAGTACCGTGGGGAAA GTTG-3′) and D3B (5′-TCGGAAGGAACCAGCTAC TA-3′) were used to amplify D2D3 of 28S rDNA region (Nguyen et al., 2017). Obtained sequence was used for a Blast search in GenBank (Altschul et al., 1997). The data set was analyzed using maximum likelihood (ML) method in MEGA 6 program with

Thi Duyen Nguyen, Huu Tien Nguyen, Thi Mai Linh Le, Thi Tuyet Thu Tran, Neriza Nobleza, Quang Phap Trinh

Journal of Nematology, Volume 51 , 1–4

Article | 04-December-2017

A New Species of the Rare Genus Anguillonema Fuchs, 1938 (Nematoda: Hexatylina, Sphaerularioidea) with Its Molecular Phylogenetic Study

monodelphic-prodelphic reproductive system, 15 to 19 mm long conical tail with broad rounded tip, and males absent. The new species is compared with two known species of the genus, Anguillonema poligraphi and A. crenati. Molecular phylogenetic studies of the new species using partial sequences of small subunit (SSU) rDNA revealed that it forms a clade with an unidentified nematode species and two species of the genus Howardula. In phylogenetic analyses using partial sequences of the 28S rDNA (D2-D3

MAHYAR MOBASSERI, MAJID PEDRAM, EBRAHIM POURJAM

Journal of Nematology, Volume 49 , ISSUE 3, 286–294

research-article | 30-November-2020

A new cyst-forming nematode, Cactodera tianzhuensis n. sp. (Nematoda:Heteroderinae) from Polygonum viviparum in China with a key to the Genus Cactodera

length of stylet, tail and hyaline tail in second-stage juvenile, and the surface differentiation in eggs (Subbotin et al., 2010). However, traditional identification of cyst forming nematode based on morphology is imprecise and time-consuming to separate the related species. During the past 30 years, molecular data, including ITS-rDNA, D2-D3 region of 28S-rDNA, are more accurate tool for identification of cyst-forming nematode species. Sequence analysis of the ITS-rDNA and the D2-D3 region of 28S

Wenhao Li, Huixia Li, Chunhui Ni, Mingming Shi, Xuejuan Wei, Yonggang Liu, Yiwen Zhang, Deliang Peng

Journal of Nematology, Volume 53 , 1–15

research-article | 30-November-2019

First report of Meloidogyne javanica infecting Zinnia elegans in Ceará State, Brazil

were prepared according to Taylor and Netscher (1974). The determination of the esterase profile was made according to Carneiro and Almeida (2001), using 20 female. For molecular identification, the D2 to D3 region of 28S rDNA segment was amplified and sequenced using the primers D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and D3B (5′-TCGGAAGGAACCAGCTACTA-3′) (De Ley et al., 1999) and ITS primers with VRAIN2F (5′-CTTTGTACACACCGCCCGTCGCT-3′) and VRAIN2R (5′-TTTCACTCGCCGTTACTAAGGGAATC-3′) (Vrain et al., 1992

Francisco Jorge Carlos Souza Junior, Mayara Castro Assunção

Journal of Nematology, Volume 52 , 1–4

research-article | 13-April-2020

First molecular characterization of an Iranian population of Schistonchus caprifici (Gasparrini, 1864) Cobb, 1927 (Rhabditida; Aphelenchoidea)

supported clade of S. caprifici. This is the first molecular phylogenetic study of the species from Iran, showing D2-D3 sequences of the studied Iranian population is identical to those of the majority of previously sequenced populations. Figure 1: Bayesian 50% majority rule consensus tree inferred from D2-D3 large subunit (LSU) rDNA gene sequences of Iranian population of Schistonchus caprifici (Gasparrini, 1864) Cobb, 1927 under the GTR + I + G model. The newly generated sequences are in bold font

Hadi Karimipour Fard, Hamid Zare

Journal of Nematology, Volume 52 , 1–3

research-article | 30-November-2018

Serendipitous identification of Pratylenchus curvicauda from the grainbelt of Western Australia

regions of the large subunit ribosomal genes (28S), which is thought to evolve slowly, have been used to examine the evolutionary relationships among species of many genera including Pratylenchus (Al-Banna et al., 1997). Pratylenchus teres, which was previously considered to be endemic to Western Australia, has recently been re-described as Pratylenchus quasitereoides using traditional methods and sequences of the 28S-D3 region of the rDNA (Hodda et al., 2014). The latter species is reported to occur

Farhana Begum, John Fosu-Nyarko, Shashi Sharma, Bill Macleod, Sarah Collins, Michael G. K. Jones

Journal of Nematology, Volume 51 , 1–15

research-article | 17-March-2020

Characterization of root-knot nematodes infecting mulberry in Southern China

through molecular phenotyping is required to be certain. Molecular profiles and phylogenetic relationships The primer pairs D2A/D3B and 26S/V5367 were used to amplify the D2-D3 region of the 28S and rDNA-ITS gene sequences of root-knot nematodes in the Guangdong, Guangxi, and Hunan province of China. The amplified products were 765 bp and 715 bp, respectively. The sequence of the amplified product was submitted to GenBank for a BLAST search, and the results revealed the highest similarity (99-100

Pan Zhang, Hudie Shao, Chunping You, Yan Feng, Zhenwen Xie

Journal of Nematology, Volume 52 , 1–8

research-article | 30-November-2020

Detection of Pratylenchus zeae and P. brachyurus parasitizing plants from the caatinga biome, Ceará, Brazil

identification of specimens from the population of Pratylenchus was carried out by amplifying and sequencing the regions ITS primers with VRAIN2F (5´-CTTTGTACACACCGCCCGTCGCT-3´) and VRAIN2R (5´-TTTCACTCGCCGTTACTAAGGGAATC-3´) (Vrain et al., 1992) and D2-D3 of 28S rDNA segment with the primers D2A (5´-ACAAGTACCGTGAGGGAAAGTTG-3´) and D3B (5´-TCGGAAGGAACCAGCTACTA-3´) (De Ley et al., 1999). The consensus sequences were formed from the forward and reverse sequences, using the Staden package (Staden et al., 1998

Francisco Jorge Carlos Souza Junior, Mayara Castro Assunção

Journal of Nematology, Volume 53 , 1–5

Original Paper | 28-June-2017

Molecular Study of Indigenous Bacterial Community Composition on Exposure to Soil Arsenic Concentration Gradient

Community structure of bacteria present in arsenic contaminated agricultural soil was studied with qPCR (quantitative PCR) and DGGE (Denaturing Gradient Gel Electrophoresis) as an indicator of extreme stresses. Copy number of six common bacterial taxa (Acidobacteria, Actinobacteria, α-, β- and γ-Proteobacteria, Firmicutes) was calculated using group specific primers of 16S rDNA. It revealed that soilcontaminated with low concentration of arsenic was dominated by both

Semanti Basu, Tanima Paul, Priya Yadav, Abhijit Debnath, Keka Sarkar

Polish Journal of Microbiology, Volume 66 , ISSUE 2, 209–221

research-article | 24-April-2019

Description of Rotylenchus rhomboides n. sp. and a Belgian population of Rotylenchus buxophilus (Tylenchomorpha: Hoplolaimidae)

morphology and morphometrics along with molecular characteristics and phylogeny of the D2-D3 expansion segment of 28S rDNA, ITS rDNA, and COI mtDNA sequences. Materials and methods Sampling and nematode extraction The soil and root samples were collected around the rhizosphere of banana (Musa basjoo Siebold & Zucc. ex Iinuma) (GPS coordinates N: 51°2′6.8″, E: 3°43′22.7″) and Yam (Dioscorea tokoro) (GPS coordinates: N: 51°2′6.9″, E: 3°43′22.6″) at the Botanical garden of Ghent University. The nematodes

Huu Tien Nguyen, Quang Phap Trinh, Marjolein Couvreur, Phougeishangbam Rolish Singh, Wilfrida Decraemer, Wim Bert

Journal of Nematology, Volume 51 , 1–20

original-paper | 28-March-2019

Predominance of Lactobacillus plantarum Strains in Peruvian Amazonian Fruits

restriction analysis of the amplified product. These genes are conserved among bacteria but show small variations that allow LAB species identification (Mohania et al. 2008). Using ARDRA of 16S rDNA it is possible to differentiate the main LAB present in wine fermentation (Rodas et al. 2003), but to ensure the identification many authors have used the sequencing of the complete 16S rDNA gene (Reginensi et al. 2013). Although the sequencing of 16S rRNA genes is still considered the gold standard for

JOHANNA SÁNCHEZ, CARLOS VEGAS, AMPARO IRIS ZAVALETA, BRAULIO ESTEVE-ZARZOSO

Polish Journal of Microbiology, Volume 68 , ISSUE 1, 127–137

Research Article | 26-September-2018

First Reports, Morphological, and Molecular Characterization of Longidorus caespiticola and Longidorus poessneckensis (Nematoda: Longidoridae) from Ukraine

SOLOMIA SUSULOVSKA, PABLO CASTILLO, ANTONIO ARCHIDONA-YUSTE

Journal of Nematology, Volume 49 , ISSUE 4, 396–402

research-article | 31-August-2020

First report of potato rot nematode, Ditylenchus destructor Thorne, 1945 infecting Codonopsis pilosula in Gansu province, China

length: 60.2 ± 5.0 (55.5-67.7) μm, ABW = 16.5 ± 2.5 (13.4-20.1) μm. These morphological characteristics matched with Ditylenchus destructor by Thorne. (Thorne, 1945). DNA of single nematode (n = 5) was isolated using the Proteinase K method (Kumari and Subbotin, 2012) and amplification of rDNA-ITS region and D2/D3 fragments of the 28S rDNA sequencing were performed with the universal primers 18S (5′-TTGATTACGTCCCTGCCCTTT-3′) and 26S (5′-TTTCACTCGCCGTTACTAAGG-3′) (Vrain et al., 1992). D2A (5

Chunhui Ni, Shuling Zhang, Huixia Li, Yonggang Liu, Wenhao Li, Xuefen Xu, Zhipeng Xu

Journal of Nematology, Volume 52 , 1–2

research-article | 26-March-2021

Morphological and molecular characterization of Butlerius butleri Goodey, 1929 (Nematoda: Diplogastridae) from South Africa: First report

al., 2006). Following DNA extraction, the polymerase chain reaction (PCR) was carried out using an Eppendorf Mastercycler gradient thermal cycler (Eppendorf, Hamburg, Germany); more details are provided in Table 1. The amplification tube contained 12.5 μl master mix (Promega Corporation, USA), 1 μl of each of the primers (i.e. forward and reverse), 5 μl DNA, and 5.5 μl ddH2O. Table 1. Polymerase chain reaction steps used for amplification of the SSU and LSU rDNA genes. 35 cycles

Chantelle Girgan, Gerhard Du Preez, Hendrika Fourie, Milad Rashidifard

Journal of Nematology, Volume 53 , 1–12

research-article | 30-November-2018

Morpho-molecular characterization of Colombian and Brazilian populations of Rotylenchulus associated with Musa spp

Donald Riascos-Ortiz, Ana Teresa Mosquera-Espinosa, Francia Varón De Agudelo, Claudio Marcelo Gonçalves de Oliveira, Jaime Eduardo Muñoz-Flórez

Journal of Nematology, Volume 51 , 1–13

research-article | 17-March-2020

First report of a stunt nematode Tylenchorhynchus zeae on corn in Gansu Province, China

the Proteinase K method (Kumari and Subbotin, 2012), and the internal transcribed spacer1 (ITS1) region of rDNA and D2/D3 fragments of the 28 S rRNA were amplified with universal primers rDNA2 and rDNA1.58 s (Szalanski et al., 1997), D2A and D3B (Castillo et al., 2003), respectively. PCR products were sequenced by Tsingke Biological Technology (Beijing, China). The ITS1 sequence (MN757910, 721 bp) and D2/D3 sequence (MN757911, 802 bp) were submitted to GenBank and compared with published sequences

Zhi Peng Xu, Hui Xia Li, Yong Gang Liu, Bao Cang Ren, Chun Hui Ni, Jin Hui Ma

Journal of Nematology, Volume 52 , 1–2

Original Paper | 27-September-2017

Bacterial Communities from the Arsenic Mine in Złoty Stok, Sudety Mountains, Poland

Investigations of bacterial communities and characterization of mineralogy of the environment in the Złoty Stok As-Au deposit werecarried out. PXRD analysis revealed the presence of picropharmacolite as the most common secondary arsenic mineral in the mine. Total DNA was extracted from slime streams or slime biofilms samples to investigate the bacterial communities. PCR amplification of 16S rDNA was performed followed by subcloning of its products. Over 170 clones were analyzed by means of RFLP

Tomasz Cłapa, Dorota Narożna, Rafał Siuda, Andrzej Borkowski, Marek Selwet, Cezary J. Mądrzak, Ewa Koźlecka

Polish Journal of Microbiology, Volume 66 , ISSUE 3, 375–381

research-article | 30-November-2019

First report of Meloidogyne hapla on kiwifruit in South Africa

using CLUSTAL W (Thompson et al., 1994). The length of each alignment was 946 and 1186 bp for ITS rDNA and 28S rDNA, respectively. Bayesian inference was used to reconstruct the phylogeny, with Bayesian trees generated using the Bayesian inference method as implemented in the program MrBayes 3.1.2 (Ronquist and Huelsenbeck, 2003). The GTR + I + G model was selected using jModeltest 2.1.10 (Guindon and Gascuel, 2003; Darriba et al., 2012). Analysis using the GTR + I + G model was initiated with a

Ebrahim Shokoohi, Phatu W. Mashela

Journal of Nematology, Volume 52 , 1–5

Research Article | 17-October-2018

First Report of Stubby-Root Nematode, Paratrichodorus minor, on Onion in Georgia, U.S.A

segments of 28S rRNA, and ITS1 rDNA were amplified using primer pairs 360F (5′ CTACCACATCCAAGGAAGGC 3′)/932R (5′ TATCTGATCGCTGTCGAACC 3′), D2A (5′ ACAAGTACCGTGAGGGAAAGTTG 3′)/D3B (5′ TCGGAAGGAACCAGCTACTA 3′), and BL18 (5′ CCCGTCGCTACTACCGATT 3′)/5818 (5′ ACGARCCGAGTGATCCAC 3′), respectively (Riga et al., 2007; Duarte et al., 2010; Ye et al., 2015; Shaver et al., 2016). The obtained PCR fragments were purified using QIAquick Gel Extraction Kit (Qiagen Inc., Santa Clara, CA, USA), sequenced and deposited

Abolfazl Hajihassani, Negin Hamidi, Bhabesh Dutta, Chris Tyson

Journal of Nematology, Volume 50 , ISSUE 3, 453–455

Article | 21-July-2017

Data on Some Species of the Genus Coslenchus Siddiqi, 1978 (Rhabditida, Tylenchidae) from Iran

phylogenetic studies based on partial sequences of 28S rDNA D2/D3 fragments, all species formed a clade with high Bayesian posterior probability in Bayesian inference, indicating the monophyly of the genus. The clade of Coslenchus spp. formed a highly supported monophyletic group, a sister clade to two species of the genus Aglenchus.

YOUSEF PANAHANDEH, EBRAHIM POURJAM, MAJID PEDRAM

Journal of Nematology, Volume 48 , ISSUE 4, 268–279

Research Article | 03-December-2018

Description of Gracilacus paralatescens n. sp. (Nematoda:Paratylenchinae) found from the rhizosphere of Bamboo in Zhejiang, China

slender, slightly curved and 17.5 to 18.9 µm long. In the phylogenetic analysis based on 18S, D2-D3 of 28S and ITS regions of rDNA, the new species is clustered with Paratylenchid species having longer stylet length. Morphologically, the new species belongs to Group 9 of Paratylenchus sensu lato and is most similar to G. latescens.

Munawar Maria, Ruihang Cai, Weimin Ye, Thomas O. Powers, Jingwu Zheng

Journal of Nematology, Volume 50 , ISSUE 4, 611–622

Original Paper | 28-June-2017

Safety Evaluation of Enterocin Producer Enterococcus sp. Strains Isolated from Traditional Turkish Cheeses

The purpose of this study was to determine the antimicrobial activity and occurrence of bacteriocin structural genes in Enterococcus spp. isolated from different cheeses and also investigate some of their virulence factors. Enterococcus strains were isolated from 33 different cheeses. Enterococcus faecium (6 strains) and Enterococcus faecalis (5 strains) enterocin-producing strains were identified by 16S rDNA analyses. Structural genes entA, entB, entP and entX were detected in some isolates

Mine Avci, Banu Özden Tuncer

Polish Journal of Microbiology, Volume 66 , ISSUE 2, 223–233

research-article | 30-November-2018

First report of Longidorus mindanaoensis Coomans, De Ley, Jimenez and De Ley, 2012 (Nematoda: Longidoridae) From a Mangrove Forest in Vietnam

D2–D3 expansion segments of LSU rDNA were amplified using the primers D2A and D3B (5′-ACAAGTACCGTGGGGAAAGTTG-3′ and 5′-TCGGAAGGAACCAGCTACTA-3′) (De Ley et al., 1999). The newly obtained sequence was compared with previously submitted sequences into the GenBank database (Altschul et al., 1997) using BLAST search. Multiple alignments were made using MUSCLE and Modeltest was used to select the best fit model in MEGA 6 (Tamura et al., 2013). MrBayes 3.2.6 (Huelsenbeck and Ronquist, 2001) in Geneious

Thi Duyen Nguyen, Huu Tien Nguyen, Thi Mai Linh Le, Neriza Nobleza, Quang Phap Trinh

journal of nematology, Volume 51 , 1–5

research-article | 30-November-2019

First report of Ovomermis sinensis (Nematoda: Mermithidae) parasitizing fall armyworm Spodoptera frugiperda (Lepidoptera: Noctuidae) in China

Ovomermis sinensis nematode (scale bar: 1 cm). Figure 3: Post-parasitic juvenile Ovomermis sinensis nematode emerging from Spodoptera frugiperda. Molecular analyses In the molecular analyses, the two individuals analyzed showed no polymorphism in the 18 S rDNA gene fragment detected (accession number MN367956 and MN367957). The D3 fragment of 28 S rDNA gene was uploaded with accession numbers MN367954 and MN367955. Based on the NJ trees of 18 S and D3 region in 28 S (Figs. 4 and 5

Bingjiao Sun, Fen Li, Xiaorui He, Fengqin Cao, Elizabeth Bandason, David Shapiro-Ilan, Weibin Ruan, Shaoying Wu

Journal of Nematology, Volume 52 , 1–7

Article | 03-December-2017

Taxonomy and Systematics of the Genus Makatinus Heyns, 1965 (Nematoda: Dorylaimida: Aporcelaimidae)

The taxonomy and the systematics of the genus Makatinus are discussed by means of the characterization of its morphological pattern and the first molecular (D2–D3 expansion segments of 28S rDNA) analysis of a representative of this taxon, Makatinus crassiformis from Costa Rica. The presence of two or more pairs of male ad-cloacal genital papillae is the most characteristic autapomorphy of the genus, but the status of its species on this concern differ among them. Both morphological and

REYES PENA-SANTIAGO, INGRID VARELA

Journal of Nematology, Volume 49 , ISSUE 3, 245–253

Original Paper | 26-August-2016

Characterization of Rhizobial Bacteria Nodulating Astragalus corrugatus and Hippocrepis areolata in Tunisian Arid Soils

Fifty seven bacterial isolates from root nodules of two spontaneous legumes (Astragalus corrugatus and Hippocrepis areolata) growing in the arid areas of Tunisia were characterized by phenotypic features, 16S rDNA PCR-RFLP and 16S rRNA gene sequencing. Phenotypically, our results indicate that A. corrugatus and H. areolata isolates showed heterogenic responses to the different phenotypic features. All isolates were acid producers, fast growers and all of them used different compounds as sole

Mosbah Mahdhi, Nadia Houidheg, Neji Mahmoudi, Abdelhakim Msaadek, Mokhtar Rejili, Mohamed Mars

Polish Journal of Microbiology, Volume 65 , ISSUE 3, 331–339

research-article | 30-November-2019

Further observations on Meloidogyne enterolobii (Nematoda: Meloidogynidae) infecting guava (Psidium guajava) in India

et al., 2004; Paes et al., 2012) (Fig. 4A). Taxonomic identification of M. enterolobii has proved to be very challenging based on only the traditional means and has resulted in incorrect identification and misreporting (Brito et al., 2004). Molecular characterization based on ITS rDNA sequences (NCBI GenBank accession number KT271569) and SCAR marker resulted in authentication of the species (Fig. 4B). In this line, use of molecular markers, viz., ribosomal D2D3 expansion segment, ITS rDNA, IGS

Tushar Manohar Ghule, Victor Phani, Vishal Singh Somvanshi, Maya Patil, Somnath Bhattacharyya, Matiyar Rahaman Khan

Journal of Nematology, Volume 52 , 1–9

Short Communication | 28-June-2017

Morphological and Molecular Characterization of Phoma complanata, a New Causal Agent of Archangelica officinalis Hoffm. in Poland

Beata Zimowska, Ewa Dorota Zalewska, Ewa Dorota Król, Agnieszka Furmańczyk

Polish Journal of Microbiology, Volume 66 , ISSUE 2, 281–285

Article | 21-July-2017

Morphological and Molecular Characterization of Gracilacus wuae n. sp. (Nematoda: Criconematoidea) Associated with Cow Parsnip (Heracleum maximum) in Ontario, Canada

-stage juveniles lack a stylet, the pharynx degenerated, and can be differentiated into preadult females and males based on the position of the genital primordia. The third-stage juveniles are similar to females but smaller. Phylogenetic studies using the rDNA small subunit 18S, large subunit 28S D2/D3, and internal transcribed spacer (ITS) sequences collectively provide evidence of a grouping with other Gracilacus and some species of Paratylenchus with stylet length of females longer than 41 mm

QING YU, WEIMIN YE, TOM POWERS

Journal of Nematology, Volume 48 , ISSUE 3, 203–213

Research Article | 03-December-2018

Two nematodes (Nematoda: Diplogastridae, Rhabditidae) from the invasive millipede Chamberlinius hualienensis Wang, 1956 (Diplopoda, Paradoxosomatidae) on Hachijojima Island in Japan

juvenile Oscheius rugaoensis (Zhang et al., 2012) Darsouei et al., 2014 (Rhabditidae), and juvenile and adult Mononchoides sp. (Diplogastridae) based on images, morphometrics, and sequences of 18S and 28S rDNA. A novel short 28S sequence of a separate population of Oscheius necromenus SB218 from Australian millipedes was also included in a phylogenetic comparison of what can now be characterized as a species complex of millipede-associated Oscheius. The only other nematode associates of millipedes

L. K. Carta, W. K. Thomas, V. B. Meyer-Rochow

Journal of Nematology, Volume 50 , ISSUE 4, 479–486

research-article | 30-November-2018

First report of Mesocriconema xenoplax (Nematoda: Criconematidae) from turfgrass in Portugal and in Europe

identical thus only one was included in this study. The resulting D2/D3 rDNA sequence was compared against a set of reference sequences of M. xenoplax selected from GenBank (NCBI) to cover a range of species from Criconematidae. Nucleotide sequences from isolates for which GenBank sequence data were available for the homologous fragment of D2/D3 rDNA gene were retrieved and a new multiple alignment was performed, using ClustalW integrated in software MEGA 6 (Tamura et al., 2013). A phylogenetic tree was

M. L. Inácio, L. C. Rusinque, M. J. Camacho, F. Nóbrega

Journal of Nematology, Volume 51 , 1–6

Article | 21-July-2017

Steinernema biddulphi n. sp., a New Entomopathogenic Nematode (Nematoda: Steinernematidae) from South Africa

DNA (rDNA). Phylogenetic data show that S. biddulphi n. sp. belongs to the ‘‘bicornutum’’ clade within the Steinernematidae family.

HARUN CIMEN, VLADIMI´R PU°zA, JIRI NERMUT, JUSTIN HATTING, TSHIMA RAMAKUWELA, SELCUK HAZIR

Journal of Nematology, Volume 48 , ISSUE 3, 148–158

Article | 21-July-2017

Description of Aphelenchoides macrospica n. sp. (Nematoda:Aphelenchoididae) from Northwestern Iran

based on sequences of D2-D3 expansion region of 28S and 18S rDNA, confirmed its status as a new species.

BEHROUZ GOLHASAN, RAMIN HEYDARI, MEHRAB ESMAEILI, ESMAEIL MIRAEIZ

Journal of Nematology, Volume 49 , ISSUE 1, 67–76

Original Paper | 07-June-2016

Characterization of Bacteria Isolation of Bacteria from Pinyon Rhizosphere, Producing Biosurfactants from Agro-Industrial Waste

Two hundred and fifty bacterial strains were isolated from pinyon rhizosphere and screened for biosurfactants production. Among them, six bacterial strains were selected for their potential to produce biosurfactants using two low cost wastes, crude glycerol and lactoserum, as raw material. Both wastes were useful for producing biosurfactants because of their high content in fat and carbohydrates. The six strains were identified by 16S rDNA with an identity percentage higher than 95%, three

Arnoldo Wong-Villarreal, Lizbeth Reyes-López, Hipólito Corzo González, Cristina Blanco González, Gustavo Yáñez-Ocampo

Polish Journal of Microbiology, Volume 65 , ISSUE 2, 183–189

research-article | 28-April-2020

Morphological and molecular characterization of Pungentus sufiyanensis n. sp. and additional data on P. engadinensis (Altherr, 1950) Altherr, 1952 (Dorylaimida: Nordiidae) from northwest of Iran

transferred to an Eppendorf tube containing 25.65 μl ddH2O, 2.85 μl 10 × PCR buffer and 1.5 μl proteinase K (600 μg/ml) (Promega, Benelux, the Netherlands). The tubes were incubated at −80°C (1 h), 65°C (1 h) and 95°C (15 min). The extracted DNA was stored at −20°C until use. The D2-D3 domains of the 28S rDNA were amplified with forward primer D2A (5´-ACAAGTACCGTGAGGGAAAGTTG-3´) and reverse primer D3B (5´-TCGGAAGGAACCAGCTACTA-3´) (Nunn, 1992). In total, 25 μl PCR reaction mixture was prepared constituting

Nasir Vazifeh, Gholamreza Niknam, Habibeh Jabbari, Reyes Peña-Santiago

Journal of Nematology, Volume 52 , 1–12

original-paper | 08-September-2020

Isolated Phosphate-Solubilizing Soil Bacteria Promotes In vitro Growth of Solanum tuberosum L.

rates in PVK liquid medium were 88 mg P/l * d and 115 mg P/l * d for bacterial strains A2 and A3, respectively. Therefore, bacterial strain A3 was selected because it was able to grow with tricalcium phosphate being the only phosphorus source on both solid and liquid media, and it solubilized orthophosphates to a higher rate than bacterial strain A2. The strain identification based on the 16S rRNA gene sequence. The 16S rDNA sequence was analyzed using the BLASTn algorithm and showed that bacterial

GUSTAVO YAÑEZ-OCAMPO, MARTHA E. MORA-HERRERA, ARNOLDO WONG-VILLARREAL, DENISSE M. DE LA PAZ-OSORIO, NADIA DE LA PORTILLA-LÓPEZ, JORGE LUGO, ROCIO VACA-PAULÍN, PEDRO DEL ÁGUILA

Polish Journal of Microbiology, Volume 69 , ISSUE 3, 357–365

research-article | 30-November-2019

Morphological and molecular characterization of Hoplolaimus pararobustus (Schuurmans Stekhoven and Teunissen, 1938) Sher 1963 with its first report on Zea mays roots in Namibia

, PCR reaction, and gel electrophoresis DNA from previously selected living males and females was extracted using chelex-100 as described by Rashidifard et al. (2019). Polymerase chain reaction (PCR) conditions followed the protocol of Swart et al. (2020) with the following DNA markers used for DNA amplification: 28 S rDNA: D2A (5–ACAAGTACCGTGAGGGAAAGTTG–3), D3B (5–TCGGAAGGAACCAGCTACTA–3) (Subbotin et al., 2006), and 18 S rDNA: SSU F04 (GCTTGTCTCAAAGATTAAGCC), SSU R26 (CATTCTTGGCAAATGCTTTCG

Mariette Marais, Esther van den Berg, Hendrika Fourie, Milad Rashidifard

Journal of Nematology, Volume 52 , 1–12

research-article | 30-November-2020

Basilaphelenchus hyrcanus n. sp. (Rhabditida: Tylaphelenchinae) associated with bark of a beech tree (Fagus orientalis Lipsky) from northern Iran

-D3 of rDNA by Kanzaki and Giblin-Davis (2012) showed four major clades. Based on molecular data, Kanzaki et al. (2014) erected a new subfamily Tylaphelenchinae including Pseudaphelenchus Kanzaki et al., 2009 and Tylaphelenchus Rühm, 1956 assigning them to clade one. Recently, Pedram et al. (2018) added a new genus, Basilaphelnchus Pedram et al., 2018, to this subfamily. They also considered Albiziaphelenchus Bajaj, 2012 as the fourth genus for Tylaphelenchinae. However, molecular data are

Behrouz Golhasan, Esmaeil Miraeiz, Zahra Tanha maafi, Ramin Heydari

Journal of Nematology, Volume 53 , 1–11

Article | 21-July-2017

Sectonema caobangense sp. n. from Vietnam (Nematoda, Dorylaimida, Aporcelaimidae)

Sectonema caobangense sp. n. from evergreen forest soil in Vietnam is described, including scanning electron micrograph (SEM) observations and D2-D3 LSU rDNA analysis. The new species is characterized by its 3.12 to 5.80mmlong body, lip region offset by deep constriction and 21 to 23 mm broad, mural tooth 13 to 14 mm long at its ventral side, 940 to 1,112 mm long neck, pharyngeal expansion occupying 61% to 69% of total neck length, uterus a long simple tube-like structure 292 to 363

SERGIO ALVAREZ-ORTEGA, THI ANH DUONG NGUYEN, JOAQUI´N ABOLAFIA, MICHAEL BONKOWSKI, REYES PEN˜A-SANTIAGO

Journal of Nematology, Volume 48 , ISSUE 2, 95–103

Research Article | 26-September-2018

Occurrence of Sheraphelenchus sucus (Nematoda: Aphelenchoidinae) and Panagrellus sp. (Rhabditida: Panagrolaimidae) Associated with Decaying Pomegranate Fruit in Italy

rRNA gene, D2–D3 expansion domains of the 28S rDNA, the ITS region, and the partial mitochondrial COI were carried out. Sequences of the 18S rRNA gene, the D2–D3 domains, and the ITS were analyzed using several methods for inferring phylogeny to reconstruct the relationships among Sheraphelenchus and Bursaphelenchus species. The bacterial feeder Panagrellus sp. was characterized at the molecular level only. The D2–D3 expansion domains and ITS sequences of this Italian panagrolaimid were determined

ELENA FANELLI, ALBERTO TROCCOLI, NICOLA VOVLAS, GIANLUCA SCARCIA, ANNAMARIA MINCUZZI, SIMONA M. SANZANI, ANTONIO IPPOLITO, FRANCESCA DE LUCA

Journal of Nematology, Volume 49 , ISSUE 4, 418–426

Original Paper | 10-December-2018

Culturable Endophytes Diversity Isolated from Paeonia ostii and the Genetic Basis for Their Bioactivity

Abstract Paeonia ostii is known for its excellent medicinal values as Chinese traditional plant. To date, the diversity of culturable endophytes associated with P. ostii is in its initial phase of exploration. In this study, 56 endophytic bacteria and 51 endophytic fungi were isolated from P. ostii roots in China. Subsequent characterization of 56 bacterial strains by 16S rDNA gene sequence analysis revealed that nine families and 13 different genera were represented. All the fungal strains

RUI-XIAN YANG, SHAO-WEN ZHANG, DONG XUE, JUN-HAO XUAN, YUAN-BO ZHANG, BIAO-BIAO PENG

Polish Journal of Microbiology, Volume 67 , ISSUE 4, 441–454

research-article | 02-April-2019

Description of Oscheius indicus n. sp. (Rhabditidae: Nematoda) from India

28s rDNA gene (Nunn, 1992). The amplification of near full length 18s rDNA gene was attempted by primers SSU_F_07 (AAAGATTAAGCCATGCATG) and SSU_R_81 (TGATCCWKCYGCAGGTTCAC) (Gutiérrez-Gutiérrez et al., 2012). Each PCR reaction comprised of 1 unit of Platinum Taq polymerase (Invitrogen Carlsbad, CA, USA), 1x Taq polymerase buffer, 0.2 mM dNTPs, 1.5 mM MgCl2, 0.4 µM forward and reverse primers and 6 µl of template DNA. The thermocycling conditions for ITS were – Initial denaturation at 95 °C for 5

Puneet Kumar, Wajih Jamal, Vishal S. Somvanshi, Khushbu Chauhan, Sabia Mumtaz

Journal of Nematology, Volume 51 , 1–11

research-article | 24-April-2020

Cephalenchus driekieae n. sp. (Nematoda: Tylenchidae) from South Africa, a new member of the genus with a long pharyngeal overlap

). The following primers were used for amplification and sequencing: SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R26 (CATTCTTGGCAAATGCTTTCG) (Blaxter et al., 1998) for SSU rDNA; and D2A (5´-ACAAGTACCGTGAGGGAAAGTTG-3´) and D3B (5´-TCGGAAGGAACCAGCTACTA-3´) (Subbotin et al., 2006) for D2-D3 LSU rDNA. Four microliters of PCR products were loaded on a 1% agarose gel (40 mMTris, 40 mM boric acid, and 1 mM EDTA) to check the quality of the amplified DNA. The DNA bands were stained with GelRed and visualized and

Milad Rashidifard, Gerhard Du Preez, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 52 , 1–10

research-article | 18-March-2020

Description of Seinura italiensis n. sp. (Tylenchomorpha: Aphelenchoididae) found in the medium soil imported from Italy

(synthesized by Majorbio, Shanghai, China) were used in the PCR analyses to amplify the near full-length SSU and D2-D3 expansion segments of LSU rDNA. The SSU region was amplified as two partially overlapping fragments; for the first fragment, the forward 988F (5′-CTC AAA GAT TAA GCC ATG C-3′) and reverse 1912R (5′-TTT ACG GTC AGA ACT AGG G-3′) primers were used and for the second part, the forward 1813F (5′-CTG CGT GAG AGG TGA AAT-3′) and reverse 2646R (5′-GCT ACC TTG TTA CGA CTT TT-3′) primers were used

Jianfeng Gu, Munawar Maria, Lele Liu, Majid Pedram

Journal of Nematology, Volume 52 , 1–11

research-article | 30-November-2019

Amphimermis enzoni n. sp. (Nematoda: Mermithidae) parasitizing damselflies and dragonflies in Argentina

: 9.94% in Ischnura fluviatilis and 4.76% in Rhionaeschna bonaerensis. Specimens deposited: all types have been deposited in the Colección Helmintológica del Museo de Ciencias Naturales de La Plata with the following accession numbers: Holotype male No. MLP-He 7639, allotype female No. MLP-He 7640, and one paratype (postparasitic juvenile) No. MLP-He 7641. Etymology: this species is named after Enzo Rusconi, nephew of JMR. DNA characterization and phylogenetic analysis The 18S rDNA sequence of

José Matias Rusconi, Cristian Di Battista, Darío Balcazar, Matías Rosales, María Fernanda Achinelly

Journal of Nematology, Volume 52 , 1–9

research-article | 30-November-2020

Morphological and molecular characterization of Iotonchus lotilabiatus n. sp. (Nematoda: Iotonchidae) from Lao Cai Province, Vietnam

illustrations were edited by using Adobe Photoshop CC 2018. DNA extraction, polymerase chain reaction (PCR), and sequencing Nematode DNA was extracted from a single individual as described by Holterman et al. (2006) and DNA extracts were stored at –20° until used as PCR template. The D2-D3 expansion segment 28S rDNA and 18S were amplified using the forward D2A (5′–ACAAGTACCGTGGGGAAAGTTG–3′) and reverse D3B (5′–TCGG AAGGAACCAGCTACTA–3′) primers (Subbotin et al., 2006) and primers 18S (18F : 5

Tam T. T. Vu, Thi Mai Linh Le, Thi Duyen Nguyen

Journal of Nematology, Volume 53 , 1–22

Article | 21-July-2017

Oscheius microvilli n. sp. (Nematoda: Rhabditidae): A Facultatively Pathogenic Nematode from Chongming Island, China

, joins together anterior to the spicules, and is partially extended and decorated with microvilli. The spicules are incompletely separated, and the tail does not extend beyond the bursa. Phylogenetic trees of 18S rDNA and internal transcribed spacer indicate that the new species belongs to the insectivora group of the genus Oscheius; it is most closely related to O. myriophilus, and the two species can be distinguished on the basis of their different body length, morphological

GUIXIN ZHOU, HUAN YANG, FENG WANG, HAORAN BAO, GUOXIANG WANG, XIANGLONG HOU, JIAN LIN, GABRIEL YEDID, KEYUN ZHANG

Journal of Nematology, Volume 49 , ISSUE 1, 33–41

No Record Found..
Page Actions